Transcript

dvl2-201

ID
ZDB-TSCRIPT-090929-7761
Name
dvl2-201
Previous Names
  • dvl2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000024983 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024983|OTTDARG00000020091|ZDB-GENE-041118-20 dvl2|OTTDARP00000020572 dvl2-001 LG_ CR376787.10 Danio rerio protein_coding KNOWN, 4331 bp
GGTGGTGAAGGAAGAGATCTCAGATGACAGTGCCAAGCTG
CCATGCTTCAACGGAAGAGTTGTCTCCTGGCTGGTGTCCT
CGGATACCCCTGCAGCAGAGCCTGTAGCTCCTCCAGTAGA
GGTCCCGTCTCAGCCCTCACCTCCTCCTCCACCCCTGCCT
CCACCTCCTGCTGAGAGGATGGCGGGCATTGGAGACTCCA
GACCTCCTTCTTTCCATCCCAACACCACAGGCAGCCTGGA
GTCTTTAGATGATCAGACAGAGACGGAGTCAGTCGTGTCT
TTCAGGAGAGAGAGACCTCGACCCAGAGAGAGCTTGGAGC
AACATGGGCCCCGTATGAATGGACAGTCCCGTTTGGACAG
ACACCTGGCCGGATATGAGAGCGCTACTACAGTGATGAGC
AGTGAACTGGACACCACAAGTTTTTGTGACTCTGATGACG
ATGATACCATGAGCAGGTTCAGCAGCTCCACTGAACAGAG
CACAGCATCTAGATTGCTCAAACGCCACCGAAGACGCCGG
AAACAGCGGCCACGACTGGAGAGGGCTTCCTCTTTCAGCA
GTGTGACTGATTCAACCATGTCCCTCAACATTATTACAGT
CACTCTTAACATGGAGAAGTATAATTTCTTGGGCATCAGT
ATCGTGGGTCAGAGCAATGAGAGAGGAGATGGAGGAATCT
ACATTGGCTCCATTATGAAGGGAGGAGCTGTAGCTGCAGA
TGGACGTATTGAGCCTGGAGACATGCTGCTGCAGGTGAAT
GATATAAACTTTGAGAACATGAGTAATGATGATGCGGTCC
GGGTGCTGCGTGAGATTGTCCACAAACCTGGACCCATCAC
CCTAACTGTGGCCAAATGTTGGGACCCTTCTCCACAAGGG
TATTTCACCCTGCCACGCAATGAGCCAATCCGGCCCATAG
ACCCAGCAGCTTGGGTCAATCACTCAGTGGCTCTGACAGG
GGCGTTTCCGTCCTATCCCAGCAGCACAATCACATCCAGC
TCATCCGTCACCGAAACCGAACGCTTTGATGAGTTTAACC
TGTCTCTTCGCTCAGACATGGCCTCGGTCGCTAAAGCCAT
GGCATCTCCAGAGTCCGGTCTAGAAGTCAGAGATCGAATG
TGGCTGAAGATCACCATTCCCAATGCTTTTCTGGGTTCAG
ATGTGGTGGAGTGGTTGTACCATCACATTGATGGCTTTCA
GGACAGACGCGAAGCTCGGAAATATGCCAGTAACTTACTA
AAGGCTGGTTTCATCAGGCACACTGTCAACAAGATCACCT
TCTCTGAACAGTGCTACTACATATTTGGAGACTTCAGCAA
CTGTGAAAACTACATGGCCAACCTTTCTCTCAATGACAAT
GATGGGTCCAGCGGTGCTTCAGACCAGGACACTCTGGCTC
CTCTTCCTCTGCCAGGGGCGACACCTTGGCCTCTGCTCCA
CTCGTTCACATACCAGTACCCTCATCCTTACTCCACCCAG
CCTCCGCCATACCATGAGCTCTCTAACTACAGCTACGGCC
CAGGCAGTGCAGGCAGTCAGCATAGTGAAGGGAGTCACAG
TAGTGGCTCCACACGCAGCGATGGAGAAAAGAGAAGGGGC
CCTAAAAGCGTTTCTGAGAGTACTGTGGGCGGCAGCGTGC
GTGATGATAAATCTCCTGGCGGGGGCGGAGCTGACTCACG
TTCTGGCAGCGGCAGCGAATCAGATTACTCTGTTCGCAGC
ACCCTGAGACGAGATCATGGCTCAGCCACACCCAGCGAAC
ACAGCCGCTCGAGTCAGCGCTCGCATCACCGCGTCCCGCC
CCCTCACCTCGCCCCGTATCCGCCCGGCATCCCCATCCCA
TACAACCCAATGATGGTGATGATGGTGCCCCAACACCCAC
ATCTGGCGCTTGGAGCACCACATCCGCAAACACCTACTCT
GCCGCCCCACCCTGGCTTACCCCCAACCGGCATCCCCGGC
GGGCCTCCAGGAGCTCCCCCGACCCGAGACCTGGGCTCCG
TCCCGCCTGAGCTGACTGCTTCCAGGCAGTCCTTCCACCT
GGCCATGGGCAACCCCAGTGAGTTTTTTGTGGATGTGATG
TAATGAAGGATGTACCCGAGTGAAGGATGGAGGTTTGTAA
TCACGTGATAACTGTGAGTTCTGCTCTGCGACGGACAGAG
ATGTAGTTTACTGTATCAGTGCAGCTCTTTAGAGTTAGTG
TTTGTCCTTGACGGTAGGAACAGGGTTTACGGAAGGGTAG
GAAGTCTTGCATAGCACAGACTTCAAAATGCATTTGGTTT
TTGTGGTATTAACCGCAACAGGGTCTGGCCTTCTAAATAA
CTCTTCTGCTAAAAAAAATACTAAAGAAAGAAAGAAAAAA
AGCCTTGTTTTCTGAGTCCTGTTATTTTCTTTAAATGTTT
CCACAAATGGCTGGAAGGCCTTCGATTAAGATCTACAAAG
GCTTCTCATGACTTGCCAGAAAATATTGCTCAAAGGAAGT
TCAAGTAAGCTTTACACACCTTTTATAAAGACCAACATTA
GGACACGATATCCACAGGAACTCGAGCTTTACGGGCATAG
TTTACCCAAAAATGAGCATTTGCTTTTAATTTACTCACCG
TCAGGCCAGCCAAGATGAAACTCTTTGTTTTTTTTCGTTC
GGTAGAACAATGAAGAAGATTTTGAGCTGGAACTTTGGTC
CCCCATAGTGATTCATAAAATAAAAAAAGTCTATGACTAA
CAGCACATTTATAGAGCAAAAAATCCAACATGTATGCAAA
ATAGAAATAATAACTGTGGATCCTGATTATACATTGAGGT
CTTATGAAGTTAAATGATCGGTCTGTGCAAGAAACGGGAC
ATTATTACCTTTTATTCACAGTCAAATGTTCTTGAGCATG
CTCATTAAAGTCTGGATGGACTTTCTATAAGCAGGCACAC
ACTTTACCGCGGCTTTGTGCTATTTGTATACATTTTTATT
AGGCTTCAGCATTCAGGATAAGCACAAGTATCACTTTGCT
GGATGATTATCCACAGTTTTTATTCCATTAGCCCAGGGGT
GCTCAATCCTGTTCCTGGAGATCTATATTCCTGTACAGTT
TAGCTCCTACCCTGATCAAACCCACCTGAACCAATTAATT
AGGACCTGAAATCCTCTTGATAATTACAGACAGGTGTGTT
TGATAAGGGTTGCAACTGAAATCTGCAGGAAGGTAGATCT
CCAGGAACAGGATTGGCCACCCCTGCATTAGCCCATATGT
TGTTATGCAACAAGAACATTTCACTCCAGACCGTCATCAG
CACATTGGTTAAGACTGGATTAACAGTAATAATGTTCAAA
ATAATGTTCAGCTTTTAGTAAAAACCAATCATTTAGCTTC
AAAAAGCCTTAATGTATTATTATTGGCATTTATATTGTTT
CAATGCACGCACATCAGTCTCAAATCAACGCTCAACCAAA
AATATAAAAGAATACAAATAATAAAAGCTTTGATGTCGCC
TTTACATTCGCTTTTTTGTATTTATATTTAGATTGCCTAC
TTTTTTTTTGACTCCATGTCAGTAGCTTTCATTTTATGAG
TAACCAAGGACCACAGTTTCAAGCAAAAAATCTCCTTTAA
TGTTCTACTGAAGTACAATTCACCTATATTCTGGATAGTC
TTGAGGGTAATTTAATTGCAAATGTTGGATTTTAAATGAA
CCATCAATTTCAGTGATAAATTATAACCTAAAATGTAACT
TTTGTAAAAAATAAACTAAAAAAAAACTGAACAAAAGGCA
TGCTTTCAAAGACCTTTAAAAGGACTCAAAACATTTGAAA
CAATGGGTCAGATGTATAATGTTTCTAAGTAGTGCTTTAA
AGTGTACCAAGGAATTCTGAAAGCTTTTCTCTAGTGTACG
ATGTACTGTATGCTTTAAAATCTGTCTTTGTACTGCTGAA
TGAAGCCAGGGATTCGTATTTGGTTATAATTAACTGAGAT
GTCAAGAACTCTTCAGATTCCTGGTTTTAGACAGCAGTCC
CTTGCTAGTATTCTTACAAATAGGCAGATTATAAAATGAT
TGTACTGAAACGGTACACACAGAGGATGTTTTAACCCCAT
AATGGTACTTTCTGGGTAGAACGGGTTGTTTAATTCTTCT
TCTACTCCAGAGCTTCTTTTTTTTTTTTGTCTCTTTATAT
GGCTGATAATCAATAGCGCCTTTTTTATATGAGTTTATAG
AAAAGTATGCAGGTGCTACATAAAGACTGAATTTCAATGG
AATGTCATGTTTAAGTGTTACATTTTTGAATATCATCAGA
TACTGTCACTTTTGCATGTCTTCACTCCAAATAAATGTAT
GATAGAATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations