Transcript

sema4e-202

ID
ZDB-TSCRIPT-090929-7704
Name
sema4e-202
Previous Names
  • sema4e-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024923 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024923|OTTDARG00000020048|ZDB-GENE-990715-7 sema4e|OTTDARP00000020527 sema4e-002 LG_ CR926137.14 Danio rerio protein_coding KNOWN, 2619 bp
GGCAGTTTAGCGCTCTCTCACACAAAGCAGCAGACACCAT
GAGCTCCATTCACTGCAGAGCCACGACTCCCAACACACTT
TCTGCTGTCTCTGACACTTAGAGCACTTTGATTTGTGCAT
TGGAGAGCTGGAATAGTGTGTGTGTGAAGAGGAACCACTG
ATGTGTCACAGGAAAACTGAGAGACTAACTTGGAAAGCAA
TGCTGACCGGTGGGCTGGGATCAACACTGGATAGCCTACC
TCGGAAAACAGTGCCAATTGGAAGTAATGGAGGACGTTTG
TTTCGTGAAGAGGGAATTTGGAACTACACCACCATGCTTC
TGAGGGATGATCTCAACCTGCTCATCCTGGGTGCCAGAGA
AGCCATTTTTGCACTTGACCTCGATGACATTACAATCAAG
AAGGCCATGTTGAAATGGGAAGTAACACGTGACCAGCAAA
ACGACTGTTCAAATAAGGGGAAAGATGCTACGAATGACTG
CAAAAACTATATTCGAATTCTTCATAAAAAGGACGACGGC
AGAATGTATGTCTGTGGAACCAAAGCGTTCAACCCCACCT
GTGGCTATTTGTCCTATGCGGATGGTAAGCTGACTTTAGA
GATCCTCCAAGAAGATACGAAAGGGAAATGTCCGTTCGAC
CCTTTTCAGCGATATACATCTGCAATGGTCGATGGAGCGT
ATTACTCTGCTACTTCAATGAACTTTCGGGGTTCAGAGCC
GGTGATGATGCGCAGCACAGAGGAAAGCATTCGAACTGAG
TTTACAAGCACCTGGCTCAGTGAACCAAATTTTATCCACA
TGGCCCACATACCAGAGGGCCAATCTAATCCAGATGGGGA
TGATGACAAGATCTATCTGTTCTTCAGTGAGACGGCAGTG
GAATATGAGTCATACACAAAGGTGGACGTGTCTCGAGTGG
CTCGTGTGTGCAAGGGTGACTTGGGTGGGCAGAGAACGCT
ACAAAAGAAGTGGACGTCATTTCTAAAAGCTAGGTTCGAC
TGTCAAGTTCCAAACACCAATCTCCCTCTTCTGGTGCAGG
ATGTTTTCCACTTGTGTCCAGATGACTGGACCACCTGTGT
TTTTTATGCTGTCTTTACCCCACAATCAGACTCCTCTCAG
TATTCTGCTGTATGTTCATACAAAATTGAAGACATCAAGA
CCGTGTTCTCGAAGGGCAAATTTAAGGCTCCGTTTAATGT
GGAGACGTCATTTGTGAAGTGGGTGATGTACTCAGGCGAG
CTTCCTGATCCCCGACCCGGAGCGTGCATTGACAATCATG
CCAGAGAAAAGGGCATCACCAAATCTCTGGAGCTTCCAGA
CAAAACGTTACAGTTTGTCAAAGACAAGCCTCTGATGGAC
CAGGCCGTCACTGCAGAGCAACCCCTGCTGGTGAAGAGAG
GAGCTGCGTTCACTAGAATAGTAGTGACCACCGCGACCGC
CTTGAATGGGACCAGCCATCAAGTCATGTTCATCGGCACA
AAGAGTGGATCAGTCCTGAAAGCTGTGAATTATAATGGAG
AGATGGTCATTATGGAAGAGATTCAGCTATTTGAGCCCTC
GGAGCCCATCAAGATACTGCGTCTTTCAAGCAGCAAGAAG
CAGCTGTATGTGGGTTCGGAGGTGGGCGTGGTTCAGCTGT
CAATCAGTGAATGTGGGCGGTACCAGACATGTCTGGACTG
TGTTCTGGCCAGGGATCCGCACTGTGGCTGGGACCTCGAT
ACTGAGCACTGTGCTACTATTAACAGCATCCACAGAACCA
GAAGCAGCACTGTGATTCAAAGCTTAAATGATGGAGATGC
CAGTCAATGTCCAGCAATAGGTGTCAGTAAACCAGTCAAC
ATCTCCTTTTACCACGGGAATACTGTGAAGCTGGGCTGCC
AGCCTTATTCCAACCTGGCGCAGGTTGAATGGCAGTTAAA
CGGGGAGCCAATCAAACCATCAAATACCATCCAGATCCTC
TCCGATGGCTTGATGATATTCAACGCATCTTTGGACGCCA
CCGGCTACTACATCTGCAGCTCCATCGAGACCGTCTCCCA
GCGCAAATACCAGACTCAGCATGTAGCGTATGATGTAAAG
ATGTGGTCCGAATCTGGAACCACAGCGTCACTTCATCATG
TTAAGGAAAAAGAGCGCACCCTAGTGGCCATGGTGGTGAT
ACTGTCACTAGTTCTAGCTGCATTGTTGATATGGAACCTG
TACAAAGGCCATTTGTCTCTGCCATGTTTACACAGGAGGG
TAAAAGACACGCAAAACAGGCACGAAGACGATGCTAACCA
GGTTCAGCCACAGAGACTAGCATCATCGGTAGTGAACTTC
AACAGCAACAACAACCACGCCAATGACCAGAGGTATTCCA
GCTCTAGAGAAACAGACAGACTCTCGACCACTGCTGGGTC
CACAGGTCAGATGTCACTGAAATACATAGATGATGAATCA
GAGATTTGAGACTTGTTAATATGCTACTTCGCCATTTACA
TGCAGACCAAGCACACTAGTGCGGATTCCTCTTATGCAGC
TTTTAACACTTGACTAAACTGTGGTTTTGACCCATTTTGT
GTGTTTGAATAATCTCTACCTTTGGAAATAAAATAAAAAA
TGTCTATTTTACTTCCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations