Transcript

cul1a-002

ID
ZDB-TSCRIPT-090929-7693
Name
cul1a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024912 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024912|OTTDARG00000020044|ZDB-GENE-030131-2603 cul1a|no_translation cul1a-002 LG_ BX927101.19 Danio rerio protein_coding KNOWN, 991 bp
CGGAGGGACTGTGTTTCCGTGAGCACGCGCTGACGGAGTT
TTTCTGTTCGTTGTTTCGGCGTCGCTCTTTTTATTTTATA
AGTGAAAAACAAAGCTCGCCACACACGCACTCGGAGTCAC
AAAAGGGAATCTTACTGACCAGGAGCCCTAGCGGTGCTGG
AGATTCATGTTTGCTTTCGTCGTTCTTTCTGGATGATGGT
TTCTTTCCTGTGTGTTGCTGTACCCTGAGGGTCCGACCCT
CCTCGTCCTCTCCCTCTCTCTCCGCTGGACCCTATGGAGG
AGTAGCTCTTGAGTGACAGGCACAAGAACCAATCGAACGG
CAGGAGGAGAGTCAGACTGCAGAGAGGATGTCGTCTAACC
GGACCCAGACCCCTCACGGTCTGAAGCAGATCGGGCTGGA
CCAGATCTGGGATGATCTGCGTGCGGGGATACAGCAGGTG
TACACCCGCCAAAGCATGGCCAAGTCACGCTATATGGAGC
TCTACACTCATGTGTATAATTATTGCACTAGTGTGCATCA
GTCGAATCAGGTCCGCGGTGGAGGCCCCGCCCCGTCCAAA
CCTTCAAAGAAAACCCCTACACCGGGAGGAGCTCAGTTTG
TGGGGCTGGAACTCTACAAGAGACTGAAGGAATTTCTCAA
GAATTACCTTACAAATCTGCTAAAGGTAGATTAAAAGAAT
AGGCTCTGTTTGAAAGACTGGAGTCCGTATGGCTTTTTAA
TTCAAGTACAGTTTATCAAACAAGTTAATAAAAAAAATAG
TAAGTATTAAAATGTTTTTGAAGATTTTTATGTGATTAGC
AAAATTTTTATCATCATTACTCCAGTCTTTAATAACACGC
GATCCGTCAAAGATAATTATGATATGCTGATTTGATGCTT
AAAGGGGTGGTCCACTACGATATCATATGCTAAACTTTAG
TTGATGCATAATATAACGGTGTGAACATAAACAACATCTC
TGAATGTAATATGCTCAAAGCTCAACGCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations