Transcript

dkk3b-201

ID
ZDB-TSCRIPT-090929-7634
Name
dkk3b-201
Previous Names
  • dkk3-001
  • dkk3b-001
  • si:dkey-80c24.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024846 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024846|OTTDARG00000020004|ZDB-GENE-061207-74 dkk3b|OTTDARP00000020473 DKEY-80C24.6-001 LG_ CR759887.7 Danio rerio protein_coding NOVEL, 1118 bp
GGCACAGACCGACTCTGAGTCCAGCCAGCAGTGACTGACT
CCCCGGAGCTCAACGCGATGCTGAAATCGATGATATTGTG
TCTCTGTGTGGGTTTAGCAGTGGGCAGTTCAGTTCACCGA
GGCGCGCATCTGGACATCAGCGATACCCTGGAGGAGCATG
TGGCTCACGGACAAACCACTTTAAACGAGATGTTCAGAGA
GGTGGAGAAACTGATGGAGGACACACAGCACAAGCTCGAG
GAGGCTGTGCATCAGATGGAGAACGAGACTACAAACTCAC
TGTTAAATGGACGCGACTTTCCAGACAACTTTCACGATGA
AACTACGACAGAAATTAAGTTGGGGAATCGAACCATTCAG
CTGATAGAGAGAATCAACAAGAAAACGGACAATAAAACCG
GGAAGACTCATTTTTCCAGAACTCTCATTCAGAACACTGA
ACGGTGGAATGAAGTAGATCATGAGTGTATGATTGATGAA
GACTGCGGAGATGGAAGTTTCTGTCTGTATGAGATTGTCA
CCTCCAAATGTGTCCCGTGCCAGACAACTAATATGGAGTG
CACAAAGGATGTGGAGTGTTGTGGAGATCAGCTGTGTGTT
TGGGGTGTTTGTGCTCAGAACAAAACCAAAGGACAGTCGG
GAACAATCTGCCAGAACCAGAATGACTGCAGTCCTCAGCA
CTGCTGCGCCTTCCACAAGGCCCTGCTGTTCCCCGTGTGT
CGGCCCAAACCGCAGGAAGGTCAGGGCTGTGAGCGTGAGG
GGAATCAGCTGATGGAGGTGCTGCTGTGGGAGGATGAGGG
TCCGCGCGAGCACTGCCCCTGTGCTGCGGGTCTGCTCTGC
CAACAGATACAGAAATCATCAGTGTGTGTGGATGAGAGAC
ATGCCTCCGGTGAAGGAAATGAGGACTGATCACAGAATCT
GCTTTTGTGTATAATTGCAGCACCAAAGTACCTAAACGAC
TTTCCTAATTCAGCTGGAGAAGCTCTAATTTATATCTTGT
TGGAATTGTGTCATTTGTACGCCACTACTGACATCAAAGA
GTGTTTTTAAAAAGTGTAATTTTAGATAAATAATGACAAT
GTGCTGAATATCTGGACATTAAACCACTTCATAATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations