Community Action Needed: Please respond to the NIH RFI
Transcript

ccnl1b-003

ID
ZDB-TSCRIPT-090929-7601
Name
ccnl1b-003
Previous Names
  • ccnl1-003
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024810 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024810|OTTDARG00000019982|ZDB-GENE-030131-4813 ccnl1b|no_translation ccnl1-003 LG_ CT027583.9 Danio rerio protein_coding KNOWN, 1218 bp
CCCATGGTGGTAAGTGTCACAGAAAACACCCGAACTCCTC
AGGCACAAGACCCAGGAATCCCTCCCACCTCATTGGCTGG
CCTTTTCGAGACTGCCAGCCAATCCAGTGAGAGCTCTCAG
CGGAGGTTCTCTGAATGGAAGGCATTGGCTTTGCTGGGGG
GCCAGGATTTCTTTTTGTTTTTTCCAGTTTATAGTTAGTT
GTACACTTTTTTTTTTTTTTCCTCTCTAAATCCAAATATT
TTTTTTTGATATACGGTATGTTACTGTTTTCATATGAATC
CCTTTCATGTGAATTGTTACAGTAAATGATCTGCCATATA
GTTATTCTTGCCTCTCCTCATATCTTTTTGATTTGGCGTT
TTAATTTTGACAAACTTTGCCATGACTCATTGCTCAAATA
TGTTCAAATTATATTAGCTCCTCCATCATGGTTACGTTTT
AAAAACTGAGGGAAAGGACATGAAGTTAAGAGACTCCATA
AGAAGCCATATATATATGAGAGAGAGAGCATGGCAGGTGT
TGCATAGGTGCTTGTTTGTGTTTTTCAGGAACTATATGAA
TGATGCCCTCAGAACCAGTGCATTTGTGAGGTTTGAACCT
GAGACCATTGCGTGTGCCTGCATTTACCTCGCTGCTCGAG
TACTACAGATTCCTCTTCCTTCCAAACCACACTGGTTTCT
TCTATTTGGTGCTACTAAGGAGGACATCAAAGAGATCTGT
ATTAACACAATGAAGTTGTATTCTAGAGAAAAGCCTCACA
GTGAACAGCTTGAGAGGCAGGTGGAGAAGAGGAAAATATT
CCTGGAGGAGGCCAGACTAAAAGCCAGAGGCCAGAATCCC
AATGGCACACCAGCTCTCGCCTCCATTAATGGATTTTCCC
CTGCGTCCAAACCCTCTTCTCCCCGAGATGTGAAGATGGA
TGATAAATCTCCAAACTCTAAACTAAAGGAGCCAGAGAAC
AGACAGTTGTTTGCCAAAAGCCCACTGAATGGAAGTATAA
AAAAGGAGGACGGCAAAGTGTTTCAGAATGGCAAGAACCA
CAGCCGGTCCCGATCTCGCTCTACGTCTCGTTCTCCACAC
AGACATCGAAGGAGCCACTCAGGAACGTACAGCTCTCACA
GCAGCCACAGTCCGTCTCCACGTCAAAAAGCCAGAAGACC
GTCACCCATCAGCCAACTCAGGACAGACCGAGACCGACCC
AGCGAAACCAGCCGTCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations