Transcript

ccnl1b-201

ID
ZDB-TSCRIPT-090929-7599
Name
ccnl1b-201
Previous Names
  • ccnl1-001
  • ccnl1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024808 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024808|OTTDARG00000019982|ZDB-GENE-030131-4813 ccnl1b|OTTDARP00000020444 ccnl1-001 LG_ CT027583.9 Danio rerio protein_coding KNOWN, 2025 bp
CGGGATTTCACTGTTCCAACGCAACGAGTGACGTCACAAA
CGTTGACGTCACTTCCGCCGTTGAAGTGCGTCAATCGCGA
AACGTTGCCATTTCCGCCTGGCAGACGAAAGGTCTACGTT
TTGTGATAGCGAGTTACACCATCAAATATGTCTCTTGGCA
TGTTATCTCCTCATCTGAACACTCCACCACCAAATAACCA
GGGCATTCTTATTGGCGATAAAGTGTATTCGGAGGTGTTT
CTGGCCATCGACAACTCGATCATACCCGAGGACAGGCTGA
GCACGACCCCGTCCATGCTGGATGGCCTCGACCATGAGAC
CGAGACAGACCTACGGATTCTGGGCTGCGAACGCATTCAG
TCAGCCGGGATTCTCCTTCGTCTGCCACAGGTGGCGATGG
CGACGGGACAAGTAATTTTTCAAAGATTCTTTTTCTCGAA
GTCCTTCGTAAAGCACAACTTTGAGATTGTTGCTATGGCC
TGCGTGAACTTGGCTTCAAAGATTGAGGAGTCGCCAAGAC
GAGTGAGGGATGTGATCAACGTTTTCCACCATTTGAAACA
AGGAAAGGGTAAAAAGAGCACACCCCTCATTCTTGATCAA
AATTACATTAATACCAAGAACCAAGTTATTAAAGCTGAGC
GTCGTATCCTGAAGGAGCTGGGCTTCTGTGTTCATGTCAA
ACATCCACATAAGATTATAGTCATGTACCTGCAAGTGCTG
GAATGTGAGAAGAATCAGATGCTGGTTCAAACAGCATGGA
ACTATATGAATGATGCCCTCAGAACCAGTGCATTTGTGAG
GTTTGAACCTGAGACCATTGCGTGTGCCTGCATTTACCTC
GCTGCTCGAGTACTACAGATTCCTCTTCCTTCCAAACCAC
ACTGGTTTCTTCTATTTGGTGCTACTAAGGAGGACATCAA
AGAGATCTGTATTAACACAATGAAGTTGTATTCTAGAGAA
AAGCCTCACAGTGAACAGCTTGAGAGGCAGGTGGAGAAGA
GGAAAATATTCCTGGAGGAGGCCAGACTAAAAGCCAGAGG
CCAGAATCCCAATGGCACACCAGCTCTCGCCTCCATTAAT
GGATTTTCCCCTGCGTCCAAACCCTCTTCTCCCCGAGATG
TGAAGATGGATGATAAATCTCCAAACTCTAAACTAAAGGA
GCCAGAGAACAGACAGTTGTTTGCCAAAAGCCCACTGAAT
GGAAGTATAAAAAAGGAGGACGGCAAAGTGTTTCAGAATG
GCAAGAACCACAGCCGGTCCCGATCTCGCTCTACGTCTCG
TTCTCCACACAGACATCGAAGGAGCCACTCAGGAACGTAC
AGCTCTCACAGCAGCCACAGTCCGTCTCCACGTCAAAAAG
CCAGAAGACCGTCACCCATCAGCCAACTCAGGACAGACCG
AGACCGACCCAGCGAAACCAGCCGTCACTCTAACAAGAGG
AGGAGGTCACGGAGCAGATCTCGCAGCAATTCAAGAGAAA
GAGTCCGCGATCGTGACTACATCAAACACAAACAGGAGGG
CAGCGGCTCAGGGCACCACTGGGACCATCGGGACCGTGAG
CGTGACCGTTCACGTGATCATGGACGAAACAAGCGCCAGA
GCCGATCACATTCTGGACACAGTCATAGCAGACACAGGAG
ATGAAGCACAATTATGGACAACAGGACAAGACTAACGCTT
GCTTCGAAACGCTGTTGTTTATTAACTGGTTAAGAAGTGG
ATGTTCTATCAATGTTACTCTTCTTGCATCTGACCGGTTC
AGTTGGGCAAGGTAGTGGTGCCTTTTTATGTATTTGACAA
TTTAAAAAAGTGTTTTACTTTAAACTTGAAAGTGAACAAC
AGACGGACTGATCAAAATCTGCCTCTATCAGGGAACACAT
TCGCACAGAGCAGACGATACCTGTGCATGTTCAATGTCTT
TTCTTTTTTTCATCAAATGTACATATAAAGCCTATTTTTA
TGATGTCAGGAGACTTTGTATTCATCTTTCTCTGCAGAAA
ATAAAAAGGATATAACATTCTACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations