Transcript

ptf1a-201

ID
ZDB-TSCRIPT-090929-75
Name
ptf1a-201
Previous Names
  • ptf1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002086 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002086|OTTDARG00000001954|ZDB-GENE-030616-579 ptf1a|OTTDARP00000001841 CH211-142H2.2-001 LG_ AL845362.4 Danio rerio protein_coding NOVEL, 798 bp
ATGGACACTGTGTTGGATCCATTCACAGGCTTAGACTCTT
TCTCCTCCTCTTATTTCGACGACGATGACTTCTTTACGGA
CCACTCTTCGAGAGACCACTTGGACACAGACGACTTTCTG
GACGAGGATGTCGATTTTCTTACCAACCAAATTCAAGAAT
ATTACAAGGATAGTCGGATATCACAGGACGGAGATTATTG
TGACGTTGGCAACTTCTCCTTTTCCTCGTCATCTTCGACT
TTTTCTTACGGATGCGCGGACAGCACCTCAGAGCTGTCCC
CTCACAGAGACGGAGGCTTACTGAAGAGGCGGAGGCGCAT
GAGGTCTGAAGTGGAGATGCAACAGTTGCGTCAAGCTGCC
AACGTCCGGGAGCGACGGAGGATGCAGTCCATTAACGATG
CTTTCGAGGGACTGCGATCTCACATCCCAACACTGCCATA
CGAGAAGAGACTTTCAAAAGTTGACACTTTACGCCTAGCA
ATTGGCTACATAAACTTTCTTGCGGAACTGGTGCAGTCGG
ACATGCCAATTCGGAATCCACACAGTGACGCCTTAAACCA
ACCGAAAAAAGTCATCATTTGCCACCGAGGAACAAGATCC
CCATCTCCAAATGACCCAGACTACGGGTTGCCTCCTCTCG
CAGGACACTCTCTTTCATGGACTGATGAGAAGCAGTTAAA
AGACCAGAATATCATTCGGACAGCGAAAGTCTGGACACCA
GAGGACCCACGAAAGTTGCACTTGAAATCATCAATAAACA
ATATTGAGAATGAACCCCCCTTTAATTTCATTTCCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations