Transcript

slc6a9-201

ID
ZDB-TSCRIPT-090929-7426
Name
slc6a9-201
Previous Names
  • slc6a9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024602 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024602|OTTDARG00000019872|ZDB-GENE-050105-3 slc6a9|OTTDARP00000020296 slc6a9-001 LG_ BX537271.3 Danio rerio protein_coding KNOWN, 9709 bp
ATGTCGGAGTCCAACACCACCGCTGCGGTTATGGCTGATC
AGAATGGAGCAGTTCCAGGAGAGCCAGTAAAGAGAGATGA
AAACTCCAGGAGAGGAAACTGGGGCAACCAGATTGAGTTT
GTCCTGACAAGTGTAGGCTATGCAGTGGGGCTGGGAAACG
TCTGGAGGTTCCCTTACCTCTGCTACAGAAATGGAGGAGG
TGCCTTCATGTTCCCATACTTCATCATGCTGGTGTTTTGT
GGCATCCCTCTATTCTTCCTGGAGCTCTCCTTTGGCCAGT
TCACCTCTCTCGGGTGCCTGGGTGTCTGGAAGGTCAGCCC
TATGTTTAAAGGTGTGGGCTATGGAATGATGGTAGTCTCC
ACCTACATTGGGATCTACTACAATGTGGTGATCTGCATTG
CATTTTATTATTTCTTCATGTCCATGACAAATCTGCTGCC
CTGGACGTACTGTAACAACCCCTGGAACACCCCTGACTGC
AGTGGGGTGGTGAGCACTCATCGTGCCAATGCCACTTTCG
CCAACATGTCTGCTGTTGTGTCCGGGGTAACTGAGATAGT
CAACCGCACCAAGAGGACCAGTCCCAGTGAAGAGTACTGG
AGGAACTATGTGCTTAATATCTCTGACGGCATTGGGAATT
TTGGTGAGGTGCGTCTGCCTATCCTGGGTTGTCTGGCTGT
GTCATGGTTTGTCGTGTTCCTCTGTCTTATTCGGGGAGTC
AAGTCATCAGGCAAGGTGGTGTATTTCACGGCGACTTTCC
CGTATGTGGTGCTGACGATTCTCTTCATCAGAGGAATCAC
TCTGGACGGAGCCATCAGTGGTATAAAATACTACTTGACC
CCTCAGTGGCAGAAGATTCTAGACGCAAAGGTGTGGGGGG
ACGCTGCCTCTCAGATTTTCTATTCACTGGGGTGTGCCTG
GGGTGGCCTTATCACCATGGCATCATATAACAAGTTCCAC
AATAACTGTTTCAGGGACAGTATTATCATCAGTGTAACCA
ACTGTGGCACCAGTGTGTACGCTGGCTTCGTTATTTTCTC
AATCCTGGGATTCATGGCTCATCATTTGGGGGTGGACGTA
TCAGAAGTGGCTGATCATGGTCCAGGGCTGGCATTTGTGG
CCTACCCAGAAGCCCTGACACTGCTGCCCATTTCACCACT
CTGGTCTCTGCTCTTCTTCTTCATGCTCATCCTATTGGGT
TTGGGCACTCAGTTCTGCCTGTTGGAGACTCTGGTGACGG
CTGTAGTAGATGAGATTGGAACTGACTGGATTATCAAAAA
TAAGACTTATGTCACACTGGGAGTTGCTATAATAGGTTTC
CTTCTTGGAGTGCCACTAACTACACAGGCGGGAATTTACT
GGTTGCTGCTCATGGACAACTACGCTGCCAGTTTCTCTCT
GGTCATCATCTCTTGCATTATGTGCATCTGTATAATGTAT
GTCTATGGTCACAAGAACTACTTTAAAGATGTGGAGATGA
TGCTGGGCTTCCCTCCTCCAATCTTCTTCAGGATCTGCTG
GAGATATGTGTCTCCTTTCATCATTACTTTCATTCTGATA
TTTACAGTGATACAGTATAAGCCCATTACCTACAATGACT
ATGTCTACCCTGGTTGGTCATTGGTCATTGGGTTTGCCAT
GGCTTTGTCTTCTGTTATCTGTATACCTATATATGCTCTG
TTCAAGATTGCCATGTCTGAAGGATCCACCTTTTTGGAGC
GTTTGAAGAACTCTGTGAAACCCGACCCGGACTGGGGCCC
GGCTCTCCAGGAGCACCGCAAGGGTCGATACGCCACGGCA
GGCCCCGAGTCAGTAGAGGTGTCTCCTCTCAAAGAAGATC
TGAAGGACGAGGGCAAAGACAAACTCACGGAGAAGGAGAA
AGAGACAGAGAAAAAGGACGAGATTGGTCTGACCATCCCA
GGAAGCAACGGCTCGACATTGAACCCCACACCCAGCGCAT
AGAGGACCCCTGCCCACCCTCCCCAGGACGGTTCCCATTC
CCACACTGCGGGACAGGAGACCTTTACATATTGTAAGGGC
TTTATGAAATCTAACCTCTAGAGAAATCGGTTGCCATTCA
AAACCTATTTCTTTTTTTTTGTTCTTCACATAATTTAATA
CAGCCGTTTGTTTGAAACAAAAGACATGTTCATATCCAGG
AGGTGTTTGCATACACGCATTGTGTATATAGCGCATTGTA
CAATATTTTCACTCTGTGTTGAGTAGTCTGGAGATGTGAC
TGTAGCGGCAGCAGGAGCTACAGTGAGATTTGGCTTGTGT
GTGAGAGTGAGTGTGTGTGTGCGTGTGGTGGCGGCAGTGC
TGGTCAGGTTTAAAAGCTGAAGACCAAATATTCTTTGCGG
CAATGTTGCAATGGCACTGTTAAGGGAAGTCTGAATCAGT
TCCCATTTCTGTTTATGTTCTCATCGTCCTCATTTCATTC
ACAAGCCAATATGAGTTGTCATTGGCATATATGATTTGAA
TGCACCATATTAACTCAGAAGATGTCTACTGTCCATTGAC
TAGACTACTCATACATGTTGGAGATACACACACAAAAAAC
AACAGGCCAACAGAATATCAACTCTTATTTCCCTTGAAGT
GAGGGCACATCTGCAAAAAACAACAAAGGATATTTGGTCT
TTAGCTCTTACTGACTGAGGTATCTGGACCGAGGCATATA
ACTTCTCAAGCCCATTCTCAGGGTCACACACAATTTGCTT
TTATATATGCGAATCGTTTTCCAACACCTTGAGATGAGTT
ATTGCTGATGTTGAGCGTTAGACACGAAGGCGAGGGGTTT
TCATGTAGGAACTTCCACGTGAAATGCCAAATCTGTCTAG
TCTTCCTGGCAATGTGGAGCCGAGGGGAGCATGTGTGCGA
TAACTAAAGCAACTAGTTTTCATTAGACGCAGTACTGTAG
TATGCACACTAACCCCGCTCTTCACAGAAAAAGAGGCATG
TTACCAAAAACATGTGCACAGACCTTTGTATCCTGATGAT
TTTAGTTGGTTTGTTTGTGTTTGTGTGTACAGTTTTTTTG
TCGTCTACGTGCGTTGCGAGACTTGAAATGGTGTGTGTGT
GTGTCATTTAAAGGCATCTGGCTGTGCTGAGCCAAGCGGT
CGCGCGATTGAACACTGAATTATGGATAAGTTGGCGTGTA
GAACGACTGGAGGAAAACGTAGCATCGGTTAAAATCATGA
GCTAGTTAGCTTTTGTGAGTAACAGTTGGCAATGTTAAAC
TGTGATTGTTACAGCTGAAACCACAGCATATTAGGTGTGT
TTTGTTTTGGTTTTATAGCTAATAAGGAAGGGACATACTG
GTATCGAGAGTTTGGTCATATTTTTGGTATGGCTAGATGC
CGCATATCATATCATTCCAGTGATTTTTCAATAGGGCCCC
TACTTACGATGCATAACGGTTGCAGTGGCACATATACATG
GATATAGAGTCCTGGTTACACTGTGAATTGTCTGGGAAGT
TGCCTGACATCTTTTAACAGGGAAGTCTGACAACATAGCT
GCTAATATGCTGATGCACCATGTAGAGACTTCTGAATAAA
CAGTAAATCGCTGTATATAGTCAAAGTAGTTATTACTCTC
CTGCCTTGTGCGAGGAGAAATGCAATACATATGACATGCT
CTGTTATTTTGAGTCTAAACGGGACACATACAAGCAAAAA
ATAATAATATTCAGCTTTTAAATTAGCTGTATTGTGTTAT
GAAGCTCAAGCAAATATTTTGACTCTCTTTAATGTGGCTT
TCACTACAGGGCTGTTGAATGCTTGATTCTTATTGGTTAA
TCAGTGTTCACCGTATATGTGTGCAGATATTTGTGAGGAG
ACACACAGATTAATTAGTTCCAGGCAGGTTTTGACCGCAT
TGTAGTTTCAGATCACTTCAACAAATTTTGTTAAACAACA
AAACTTAAACCAGTAAAGAGACAGATCAAATTAGTTTTTC
TCACAAAACTGCACAGCAAGATTTTTTTTTTTTTTATTAA
ATGTCTAATAGACATTCAAAAGTAGATGGTGTGACATTTA
ATAGACGTCTAACAAACCACAAGCCATCTTTCTTTTGCAG
TCCAGGAATCTAAACTTATGACTCGGTTAATTGGCGCAGT
TAGTGTAAGACTGATCAATCAACAAATCTTTTGTACATAT
CGATACTTAGTGCTAGAGTATCGATAATGTTTCGCAGCCG
GAAATATCCTGATAAATCGATATTTTATTTTTTTTATTCT
CCTATTGTAAAGTCATGAAGTTTATAACCTTCTGTTGCTG
ATCCATCTTGCAGTGTAAACTGCACCAACAGAATGCTACC
CCAGATAGTCAAGCAATGTGAACACATCTGTGATGTGACT
ACTTTGAAAATCATGCAGTCTGGACGCAGATCAATCAAAA
TCAAGCGTTCATCTGCTTCGAATGTTATCACTCGATTAAA
TGGCCATTATCAGTGGTTATCAGCTGATAAATATGGGTCA
TTAGGCTACATACTAGTAGCCCACAGATCTCCAGGTCTGT
GTTTACATTACTGTTACGGTTGGGGTAGGGGTTGACGTTA
ATAAAATACAAATAATGGGAAATTTAATTAATTATTTTAA
TATTTCTTATCAATTTCCAGCCTCAGCCGTATGTGATCTA
TAGGTGATTAACCATGTTGATGGATGATAACAGCCTTCTG
AGCCTACCAGTAGGCACAGAAGGCCCCTACTAGCCCATAT
CTATCAGCTGATAACCACTGATAATGCATTCAATCGAGTG
ATAACATTTGAATCGACAGCATCAGCCCAGTAGTATACAT
TTTAATGAACATATTATTTATGTCTTAATAAAAGTATGCT
TAGAAAAAAAAAAACTATTTTTTAATGTATTTTTTTGAAA
TAGTTGTTTGTTGCATAAAAATCAAGATGTGTTTGACGAC
TCAAAATGCTGGAGCAGGTCACAGATAAAGTCAGTATTCA
AAATGCCTGATGGCATAATAGTCATTGTTTTTTGTACACT
TTATTAATCTCTGCATGAAGGTATGTATATATAAATATTT
TCAAGATTTTATCCAAAAATATACAAAACACAATCTAACT
TTAGAAAGTAGCAAAAAAACAAATAAATAACAAGACAAAA
AAAAAAAAAGAGAGACCCAACAATATTAAAAGTAACCCTG
CTGCCTAACCAGAGATATCGGACACTCAGGGGAGTAGATA
GAGGTTCAGAGGTCATAGTTCAAGCTCACAAACACTAGCT
TTTCCTCTGTTAGACGCAGTAGATTAGAGCAGCAGAGAGA
CTAACAGCACTTTTATTTGCTAGTTCAGTTTAGCTAGCAA
AAGTATGATTAATCGCTGTCACAAAAATGAATGCACAAGA
TTGAAACCCTCTCTCATTTGTTCGATGTGTGGTCCTTAGA
CCTTGAACGTGGCATGAAGACCGTGTGTCTGTTTTTAGGA
ACTGCGTTGTGAACAGACCTTGACATACAAACTCTTTGTA
ATAGTAGACATATGTTCTGCATCAGTGCCATTCTAGCACT
GCTCCCCAACTCTTGCTCTCTCTCTATCCCGTTTTATCTC
TCGCTCTCTCTTTCTCCACTGTACAGTAATGTAAAAAAAA
GAGACAAAAACTCAACAGATGTGTTTTTTGTGTGCGTGTG
TGTGTGTGTGTTTTCTGTTTTTATCAGGGTGGGTTGCTCT
AGCGGGGTTTATTTTTTAGTTGTTTTTACTTGATTTCTTA
TTGTAACGTAGCTAATGTCATGTGTACAGTTTCCTGTGTA
GTGAACGTTCAACTGCTGAATCAAACCTAGTAGTCACAAT
TGATGTCATGTAATTTTAATCAGTATGTAATTATCCGTTT
TGCCATTTAACAAGCAGAATCTACCTTTGTAAGAGATTTG
TTCCTTTTTATTTTTATAGTACTAAAACTGTATTTTATCA
CCAGTTGTAATCATTTAGCAATGTTCAGTGACACTACAGT
TTTTTTGTTTTGTTTTTCCCTCTAAACCTCCTCAAGCCAG
CTGATCTCAAATGCATTGCCAAACAAAGGCTTTGGACTGA
AACTTGAAAACACAGGAATGCTTTTTACTGGATTGTCTGG
GTAAATTGTTTGCTGATGAGGAAGGACGAAGTCTAAAGCC
AACAATCTTCATCTCAGTATTGTAAACGCGTGTATTTATA
GCACCGCAAAACCCTTTAAGAACGTTTCTGTGGATTTTAG
TCAGCCGTGATCCAGTTTCATGTTATTCAGCACAACTGAC
AAAGCACATGGGGGGAATGTTTTAACACATAAGCCGATCT
TTTATTTATAAAATGCCCCTGAAATAAAATAAAAAACTCA
ATTAAAAGGGTCATATTATGATTTTCGGTTAACTTTAACT
TGGAAAAACATCTGCAAAGTTACAAAGAACAGAATCCACT
TCAGAGTTTCCAGCAGACACTTTGATGCCAAAAGCAAATC
AAATTGACATTGATGTCAGACCAAAATCATCATGAACACA
CTGTAAAAACCCAGTAAGTGAAGGTAACTAGAACTATTTG
AGCAAACTGATTACAACAAACCATTTAAGTTTAAAAACTA
ATCCTAATGAGCACTGTGAACTTAATTCATTTGAGTAAAC
GAAGCAATTTGAGCACAGCAAAACCCAATAAATGAAGAGA
ACTCAAACCAACTGAGTACTGTAAAACCCACTAAGTTAAG
CTAAACCGTTTGAGGAAAGCGATTGATACAAATTAAATGA
GTTAAAAAATCTCTATGAGTACTGTGAACTTACTCCATTT
AAGTTAAAGTAATGAGGAATTTAATTAACTCATTACCTTC
AACACTGAGTGTAAAACTCTTTTCAAATGAGTAGAATTAC
CTTTCAGTCAATTTTGAGTTAACTACACTCATTTCATTTA
ATCAAGGTGACTGTTGGGTTTTACATTGTATTAATCGATT
TGGTGTCAAAACCTTTTTATTTATTTGATATTCACACATT
GATGCCCTTTTGACCACCATCCTTTTTTTTTTTTAAACCT
GTTTTTTAAATGTGCTTTTTGCACAACAAAACTACAACAA
AATATATAAGAAAAAAAACAATAACAATAATAATAATACA
TATAAAATACATAAAAACACCTATGACAGAACACAGAGGG
ACAAAAGCTAAATATAATTTAGCTGCTCAGGTAATGCATA
GTTCTTATATTCCCAGAAAAATGAATTATCCTGACTTTAG
TTTTATTGTGAAATAATAGTTTGGGCACAGTATTAAAAAC
TTTATGAATAGTGAATATCAATTACACTCAATCTTTATTT
ACTATGTTATTGACGGGGGCCACTGGTTATGCTGGCTTTT
CTTCCAATGCATTAAGGTGTTCTAATATCTATTCCCATAT
TTTATAAAATATCTTTAATTTATTGTTATTGATATTTCTC
AACGCCTCCAAAGCAAGCATGTTTTGACCACCAAGTATCT
TAAAGCTTCTCTTATGACATTTACATTGGATGCTGTATCT
TTATAATGCATGTAAACCACCTTGATTTCAAAATAACATC
AACTTGACTGATTTTTGACGCAATGTTATATGTCAGTTCG
ATGTCATTTTGACATCAAGCTAGTGAATTTACATAAAATT
TATTTGAATTATTAAGATGTTTTGTTTTGATGTACTTTTG
ACATCAAGGTGCCCACTGGGTTCATAACAGTAAATCAGTA
CGTACTGTTTTTGAACACCCAAATTGCAGTGTTTTTCCAT
TAATAGACATCCAGAACTCGAATAATTCATGCTCAAGTCA
TTCCCAAGCTGACATCTTCATGTCCAAGAGGTACTGTTTT
ACAGATGCACAATAATATACTGATACAGTTTAATTCTCAG
ATTTGTCTGACAGCCAGCCTTCTGTGCGCACAATTTGACA
ACAACGATAAAGACAAATAAATTTGTCTAGCACAGTTTTT
AACAACCTTCGCTGATCAAAGTGATTTCCAGCAAGTAAAC
TAGCAAGGGAACTGATATCAACAAACATGAAACCCTCACT
CCTCCTCCTAACAGCAGAATGCCTCTGAGAACAAAAAAGT
CTTTAATCTAGACTTAGAAATATTGATGGAATGTGCTTGT
CTTATTGATGGTGGTAAGGCGTTCCAAAGCCTGGGGTCGC
AATACAGAAAGCACAATCTAACCAACATTTATGTCTCAAT
TAGGGAAAACCGTGAGTGAAGGGATCTAGTAGGCTTATGC
CAGGTTATTTAAACCCATGTGAGGTCAATTATGGTCCATC
CCAAACATTGGGTTCAATTTCAAATCAGTAGAGACAAAAA
GGAGTCTTAGAGATTAGAGATTTAAAAACAAAACTTAAAA
TGTTCAAGTCTGCATGAATCGGAAGTTGCTCTGACTTTTA
TTTCAGTATTTTCATGTACTTCCAAACAGAAGTAAGAGTA
GGTAAACATTTAGTAGCGAACGGAGAAGGACCGCCACTCC
AAACATAAAAACAAATGATAAGACTTTGAAGATTATCAAA
ACAAACAAAATCAATCGATTAGCTTGCACTGATTAATCGT
TCACCTAGGTCGTTCAAGCATAGGTCTCAAACTGGATTCC
TGAAGGAAAGCGCAGCTCTGCATAGTTTTTCTCCAAAGCT
AATCAAACACGGCTGATCCAATTAATCAAGATGTTCAAGA
CTACTAGACTATAGGCAGATGTGAGTTGGAGGTGGATGGA
GCTAAACTATGCAGAGTTGCGGCCCTCCGGGAATTGAGTT
TGAGACCATTGACCTAAAGAATAACAACAAGTGCTAGCAA
AATAAACATTTTACATTTTGAAAAACATAATATGACCCTT
TTAATAACTTGGAAATGTGACTGATCTCATCATGTCAACC
AGCTATTGGAAAGGGGACAAATAATTTTGAATAGAACCAA
ACACTTTATTTTTTTTAAGTGGATTTTGCATCTAATTTGG
CTTGGCTCTTTAACTATTTAATTAATGTAGCCGATATCAA
ACTGTTGCTTAATTTGGCAACAATTGAATTGTAAATTAAA
TTTTAAAACATAAACCTTAAGATGACAATGTGGGGCTGTG
AACAAATAAATAAAATATTAGAATTTGGTGGGAAATATGT
ACAATTATCTAGATGGCAAAATCCATTGTGCACTATTTTG
AGACTATGTGAAGCATAAAGGTCCTTTCACATCATTAAAA
TGATAACTATAATTATAATAATAGCTTAAATCTGATTGGC
TGTCAGTGTTTTTATTATTCATCAGCTCTTTCTTTTTGTA
ATTGTTATAGTTATCGTATTTGATTTGAACAGACCCTTAA
CAACTACCGAATCAGCACATCTGGACCGAAACTGTGAATT
ATTTTGGTTACACTGAAATGTTTATTCAAATAAATGTCAT
GTATTTTCATGTGGTCACGGCACTTTAAAGACACGTGTTT
GAAAGCAACAGAAAATAATTCACAACAGCAAAAAAATAAA
TCCCATTCTCTCCCATACCTCCTATATAAAACAAACGATA
TATTTACAGTAGTGTGTGTGTGTGAGTGTGTGAGCGTGTG
TATACTTCTGTGCTCATGGTGAAGTAGAATGACAAGCACA
ATGACATGAGCTCAGTACTTGATCCAACATATCTAACCAC
GTCTTTTCAACTTTAGGGCCAAACTGCATTGAATTTGTCT
TAGTCTTGTCAGCTGTATATCTTAAACTGTTCAATTTGAA
ATGGTAAATAAAGTTTATTTTAAAGATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations