Transcript

tomm70a-201

ID
ZDB-TSCRIPT-090929-7359
Name
tomm70a-201
Previous Names
  • tomm70a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024494 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024494|OTTDARG00000019804|ZDB-GENE-030131-8173 tomm70a|OTTDARP00000020208 tomm70a-001 LG_ BX004878.8 Danio rerio protein_coding KNOWN, 1981 bp
GTGAGTTTGCGCGTTAGCTGGGTGCTGCTGCGTGGATGAT
GGCTGCATCGAAGCCCGTAGAGCCTCAGTCCGGGAGTGGG
CTTCCCCGCTGGCAGCTGGCACTCCTGGTGGGGACTCCGA
TCGTCCTGGGTGTCGGAGCTGTCTACCTGTGGAATCGAAG
TCGCGCCAAGGAAAAGCAGGGGAAAAGGAACGGAGAGAGG
AAAACCCCAGAAGGAAGCGCTAGTCCTGTCCAGGGCCAGC
ACGGTGCGACAAATCCAGAGCTCGAGAACCTGAGTCCCCT
CGACCGAGCACAGTCTGCCAAGAATAAAGGCAACAAATAC
TTCAAGGCTGGCAAATATGATCATGCGATCAAGTGCTATA
CAGAAGCCATCGGCCTATGTCCCAAAGAAAAAAAAGGAGA
TCTGTCCACCTTCTACCAGAATAGAGCTGCAGCTTATGAG
CAACAGATGAAATGGACCGAAGTGATACAGGATTGCTCTC
AGGCAGTTGAGCTGAATCCTCGCTATGTAAAAGCACTTTT
CAGGCGTGCCAAGGCACTGGAAAAACTGGATAACAAAAAG
GAGTGCTTAGAAGATGTGACGGCTGTATGTATTTTGGAGG
TTTTCCAGAACCAGCAAAGTATGCTACTGGCAGACAAGGT
GTTGAAACAGCTGGGAAAAGAAAAGGCCAAAGAAAAATAC
AAGAACCGAGAGCCCCTTATGCCATCTCCTCAGTTCATCA
AATCCTACTTTAGCTCCTTTACTGATGACATCATTTCACA
ACCCCTACAGAAGGGGGAAAAGAAGGACGAAGATAAAGAC
AAAGAGGGTGAGGCATCAGAGGTCAAAGGAAGCTCAGGCT
ACCTAAAGGCAAAGCAGTATATGGAGGAGGAGAACTATGA
TAAGATCATCAGTGAGTGCACAAAGGAGATTGAGTCTGGA
GGCAGATACTCTGCTGAAGCTCTTCTGCTGAGAGCCACAT
TCTACCTGCTGATTGGCAACGCTACAGCTGCACAGCCTGA
TCTTGACCGTGTCATCAACATGAATGATGCCAGCGTCAAG
TTGCGTGCTAATGCCCTCATTAAACGTGGAAGTATGTACA
TGCAGCAGCAGCAGCCCCAGCTCTCCACGCAGGACTTCAA
CATGGCTGCAGAGATCGATCACCGTAATGCAGATGTCTAT
CACCACAGAGGACAGTTGAAGATTCTGCTGGATCAGGTAG
AGGAGGCTGTGGGAGATTTTGACGAGTGTATAAAACTTCG
ACCAGACTCTGCACTTGCCCAGGCACAGAAGTGCTTTGCA
CTTTACCGACAGGCCTACACTGGAAACAACCCATCTCAGG
TTCAGAAAGCCATGGATGGTTTTGAGGATGTCATTAGGAG
GTTTCCAAAGTGTGCTGAGGGTTATGCTCTGTATGCACAG
GCATTAACTGACCAGCAACAGTTTGGTAAGGCAGATGAAA
TGTATGATAAATGTATTGAGCTAGAGCCTGACAACGCCAC
AACATATGTTCATAAAGGTCTGTTGCAGCTTCAGTGGAAA
CAGGATCTGGAAATGGGTCTTGAACTCATTAGCAAAGCCA
TTGAAATTGACAATAAATGTGACTTTGCATATGAAACAAT
GGGAACCATTGAAGTCCAAAGAGGCAACCTGGACAAGGCT
ATAGACATGTTCAACAAGGCCATTAACTTGGCCAAATCAG
AGATGGAGATGGCCCATCTGTATTCCCTCTGTGATGCTGC
TTATGCCCAGACAGAGGTGGCCAAGAAGTATGGGCTCAAA
CCTCCCACGCTATAACTCTTGCTTCCTTTTTCCACTCTCA
ACTGCCGGGTCAGAATACAAATACCATTATCCCACGTTTT
CTTTTGCTTCATTATAAAGATCTTCATTACCAATTAAAAG
GAAGTCGGGACAGGTTCTGCTACCACACACTTACCAGTTT
TTGAGGACTGGAAGAAAATGATGGGGGAGCAGAAAAAGGA
GATGAGAAAAAATTAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations