Transcript

badb-202

ID
ZDB-TSCRIPT-090929-7343
Name
badb-202
Previous Names
  • bad-001
  • badb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024477 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024477|OTTDARG00000019794|ZDB-GENE-000616-1 badb|OTTDARP00000020195 bad-001 LG_ AL954715.13 Danio rerio protein_coding KNOWN, 494 bp
TCCAAACATTGGGACACAGATCACCCGGAAGACTGCACGC
AAGACGTTCAATCATGGCACATATGTTTAATATCTCTGAT
GATTCAGAGACAGAAACAATGGAAGACAGTGAAGACTCAA
GCCTGGATAAACACAAGAGTGGGTCGGCACAGAAAAAGCA
GCACCTCACTGTTCCTGATAGGCTGAAAGGAGAGCAACTG
GGCAGACAGAGGAACCTCTCGATGAATGAGGAGGACTTGC
TGGAAACTGGAGTTGCAGAAGATCCTCATATGCTTGGGGA
TCCTTTCAGGCCGAGATCCCGCTCAGCTCCTCCTGCTTTG
TGGGCAGCTAAGAAATACGGCCAACAGCTGAGAAGAATGA
GTGATGAGTTTGATAAAGGGATGAAGAGAGTAAAAAGTGC
AGGAACTGCGCGTCAGATGAGTCAATCGCCCAGCTGGTTG
GCATTTCTTTGGAGTCACAAAGAGTCTGATGCGGAGTCGC
GCCCCGCAGAGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations