Transcript

etv5b-201

ID
ZDB-TSCRIPT-090929-7297
Name
etv5b-201
Previous Names
  • erm-001
  • etv5b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024430 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024430|OTTDARG00000019770|ZDB-GENE-991228-4 etv5b|OTTDARP00000020165 erm-001 LG_ BX323042.7 Danio rerio protein_coding KNOWN, 2837 bp
GAGAGTGCGATACCCACTCGCAAACGCACTGTGTTTTTTC
CTCTGGGATTAACCTCATCACTCATTTTGTAAAAGCAGAG
GATTATACAAACGCTGGGCGAGGATATCACCCCCGTTTAT
CCCTGTGCGTTCCCGTTTTCCCTCCTGCTGCAGCCCCTTA
GGCCGCAGTGAGAAGCAAGCGACATGGATGGGTTTTATGA
CCAGCAAGTCCCTTTCATGGTGCCTCCAAATAAGTCTCAC
ATGCAGGAACCATCGTGCAGGACTTTCAATGACCGAAAAA
GGAAGTTTGTTGACACCGAGCTGGCACAGGATACAGAGGA
GCTCTTTCAAGACCTCAGCCAGCTACAGGAGATTTGGATA
GCAGAAGCCCAGGTACCTGATGACGAACAGTTTGTTCCAG
ATTTCCAGTCGGATAATCTGATGTTTCATGGACCTCCTCA
AACGAAAATAAAGAGGGAGATGAGCCCAAGCAGAGAGTTT
TCCCCATGTGGACAAGAGCAGAGACTCTCTCCATATGGAG
AGAAGTGCCTATATAACTACAGTGCCTTTGACAGGAAGCC
ATTCACATTCAACAAGCCACTGACTCCTCCTTCTACACCG
GCATCACCTTTTGGTTCCTCCAGCACGGCAACACATCCTG
TGCAAAAAAGAGCGATGCCACCAGCCCAAACACAGACACA
AGGAGCACCGCTTTTACCAGGACCAAATCACAGTTCCACA
TCACCCCATCAGAGAGCCCAGACTCCACTCCACAGTCAAA
GCCCACCGTTTGCTGTGCCCTGCACACCTGTCAATCACCC
AGATGCCTCCTACAGCACAGACCACAGGTTCCATCGGCAG
CTTTCCGAGCCCTGTCTTCCATTCCCACAGTCTGATGGCC
GCTGTCAAACACCTTATCCCCCACAGACCCGTGGCCATTT
TCCCCGGCATAGCCGGCCCCCTTATCAACGCCAGATGTCA
GAGCCGTTGGTGCCAATGCCTCCCCAGGGCTTTAAAAAGG
AAATGGTGGATCCTCGTTACAATGAGCAGGGTGTGCAAAA
CATGGGGCCTCCTCGCGCACCCTTGTTCCACCAACTCTCA
ATCAAACAGGAGCCCAGAGATTTCGGCTTTGACTCAGAAG
TACAGAACTGCCATTCATCTTTTGGCAAATCATCTAATTT
CTATGGCGGCAATGGTGAGGGTTTTGGGTATGACGGAGAA
GCCCATCTCTATTATGATGATGCATGTGTGGTCCCAGACC
GTCTGGAGGGCAAGCTGAAGCAGGAGGGTGGAGTTTTTCG
GGACGGCCCTCCATATCAGCGAAGGGGATCTCTGCAACTC
TGGCAGTTCCTGGTCACTCTGTTGGATGACCCGTCCAACG
GCCACTTCATCACTTGGACTGGCCGTGGGCTTGAGTTTAA
ACTCATCGAACCAGAGGAGGTTGCTCGCCGATGGGGCATA
CAGAAGAACAGGCCTGCCATGAATTACGACAAGCTGAGCC
GATCCCTCCGTTACTACTATGAGAAGGGCATCATGCAGAA
GGTTGCTGGAGAGCGGTACGTGTACAAGTTTGTCTGTGAT
CCCGATGCGCTTTTCTCAATGGCATTCCCTGATAACCAAA
GGCCCAGTCTGAAAGCAGAGCCTGATAGTCTGCAGGTTCC
TGAGGATGACACTGTCCCGCTCTCACACTTCGATGAGGCA
AACCGTGCCCCCTATCCAGCAGATGCGAGAGATCAGTGCT
TAGTAGTACCATCCTTTCCTGAAAGTTACACTTTCTGAAC
TGCTGCGCCACCACAGGGCGGACCAGAAGAACTCTCGAAT
GCATCCTCGCACTCCAAATGCAGCTCATGTCAAATTGTAA
TCGCTCCGATAAGGAATTTGTAGCGCCTGCTGACAAGTCT
CTAGACTTTCTTGCCACACTTTGTTTATTGTTATTTACTA
AACAGATTTCATGATGGGAAAATGTCTTTTTTATTTACAA
AGGGACACAACAGTATTTTCAGTATAACCTTTGATTTTAT
ATATATATATATATAAATATAAGTGTATATTTTAAAATCT
GGCTTTTGTGCACTGCTTTCTTTGTGTATTGGGCCTGGTG
TCTGCTTCAGTGAGATTTGTTGAACTTCTGACAATGCGTA
ATGATGCACCTCAGGCTGTTGTCATTATCAGAGAGTGAGT
GTATGTGTGTGTGTGTGTGTGTATAGCTTTGATTATTATG
ATCTGGAAAAATGCACAATTTTTATTTCTCCAGCTGGCCA
AGTAAAATGCTTTATAACTGTTCAGAAATAGTTTCTGCTT
TTGTATTGTGATTTTTATGGACAGGGGGCTTGGCAGAATG
GGTGAAAAAAGAGGGTAGGGGAAGTAAAGAAGTCAAATCT
ATGTATATCATGAGTATATTTTTCCAAAAGCTGAACTGAA
TTGCATTGTATAAGCTGTACGACAGACTTTTATCACTTCT
AATCTGTTCTTTTTGTACAGTGGTATGTGTGTGAATTTGC
AAACCAGCTCTTGAGATAGGGGGGAAACAGGCCTGAGCGC
AGGATCAGTTACGCTTGTGTGCCCTTTAACTGTTTATCAA
AGGATTATAGCAAGGTCATCTGATCTCTGTTCAGTACTAA
GCAAGCATGGCAAGAAACCCGCAGCTCTCTCTCCACCTTC
ACTGTCAACCTTGCTTGTCTATGCTGGGTACAGCAGACCC
CTAGTTCTGTTTCACTGTGGATAAAACTATCGTTTCATTG
TCTTTTGAAGACAATTTCTATCATTAAAAAAAATTGCAAG
TACAGTTTTGGTGTACACTTACAGATCTGTATTTTCTAAA
CTATAAGGTACAGGATAAATAAACATCCATAAATGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations