Transcript

col1a1a-002

ID
ZDB-TSCRIPT-090929-7268
Name
col1a1a-002
Previous Names
  • col1a1-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024400 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024400|OTTDARG00000019751|ZDB-GENE-030131-9102 col1a1a|no_translation col1a1-002 LG_ AL929222.6 Danio rerio protein_coding KNOWN, 697 bp
ATTAAGGAGAAGAAACACGTCTGGTTCGGAGAGGCCATGA
CCGATGGCTTCCAGTTCGAGTATGGCAGCGAGGGCTCCAA
GCCTGAGGATGTCAACATTCAGCTCACCTTCCTGCGCCTC
ATGTCCACTGAGGCCTCCCAGAACATTACATACCACTGCA
AGAACAGCATTGCATACATGGACCAGGCTTCTGGCAACCT
GAAGAAGGCTCTTCTCCTGCAGGGCTCCAACGAAATTGAG
ATCAGAGCAGAGGGCAACAGCCGCTTCACATACAGTGTCA
CTGAGGATGGTTGCACGTCGCACACCGGTGCATGGGGCAA
GACAGTCATTGACTACAAAACAACGAAAACATCCCGTCTG
CCTATTATTGACATCGCCCCTATGGACGTTGGTGCACCTA
ATCAGGAATTTGGCATTGAAGTTGGCCCAGTCTGCTTCTT
GTAAAAAAGAAATCTGGACTTGAGATTGTTTGTGAAAAAA
TAAAGATCTAAACCACCAGAGGGCGAGTAAATAGAAAGTA
AAGAGAATTGACAGGAAAGCATGGGGAGCAGAGAGAGGGG
AAGGATCGGCATAGGACCACGAGGCTGAATCGAACTCGGG
TCGCCGTGAGCACCGGAGTGCCGACGCACTAACCACTACA
CCACTGTCGCTGACGTATATACAGTATGCAACTTATTAAA
CAACACATATTTATGCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations