Transcript

col1a1a-201

ID
ZDB-TSCRIPT-090929-7267
Name
col1a1a-201
Previous Names
  • col1a1-001
  • col1a1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024399 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024399|OTTDARG00000019751|ZDB-GENE-030131-9102 col1a1a|OTTDARP00000020146 col1a1-001 LG_ AL929222.6 Danio rerio protein_coding KNOWN, 5797 bp
AGTAGGGAGTTTCTGCTGGGGTCTGGATTGGAGTCACAGA
AGACCGGACCCTACCGTGTATGATTGGAGTCTAAAGGAAA
ACAGAACTTCCCTCGCCTCAAAGAGTCTACATGTCTAATA
TTTAGACATGTTCAGCTTTGTGGATATTCGGCTGGCGCTG
TTGCTCAGCGCAACGGTGCTTTTGGCAAGAGGACAAGGCG
AGGACGATCGCACTGGCGGCAGCTGCACATTGGACGGCCA
GGTCTACAATGACAGGGACGTCTGGAAACCAGAGCCATGC
CAAATCTGCGTGTGCGACAGCGGCACCGTAATGTGCGACG
AAGTGATCTGCGAGGACACAAGCGACTGCCCCAACCCAGT
GATTCCCCACGACGAGTGCTGCCCCGTCTGCCCAGACGAC
GATTTCCAGGAGCCCAGTGTTGAGGGACCTAGAGGTTCTC
CCGGTGACAAGGGTGAGAGGGGTCCTGCTGGCCCTCCCGG
CAATGATGGAATCCCTGGACAGCCTGGCCTCCCTGGGCCT
CCAGGCCCTCCTGGACCTCCTGGCCTTGGTGGAAACTTTT
CTCCTCAGATGTCTGGTGGCTTTGATGAGAAATCCTCTCC
AATGGCTGTCCCAGGCCCCATGGGACCTATGGGCCCCCGT
GGAGCCCCTGGACCTCCTGGACCTTCCGGACCCCAAGGAT
TTACTGGTCCCCCTGGCGAGCCTGGTGAGGCTGGTGCTCC
TGGTCCAATGGGTCCCCGTGGCGCTGCTGGTCCCCCTGGA
AAGAATGGAGAGGATGGTGAGTCTGGCAAACCTGGTCGCC
CTGGTGAGCGCGGACCCCCTGGACCACAGGGTGCTCGTGG
ATTCCCCGGAACCCCTGGACTTCCAGGCATCAAGGGACAC
AGAGGATTCAGCGGTCTAGATGGAGCTAAGGGGGATGCTG
GCCCTGCTGGACCTAAGGGTGAGCCTGGTGCACCTGGTGA
GAATGGAACTCCTGGTGCCATGGGTCCCCGTGGTCTGCCT
GGCGAGAGAGGCCGTGCTGGTCCTCCTGGTGCTGCTGGTG
CTCGTGGTAATGATGGTGCCGCTGGAGCTGCTGGTCCTCC
TGGCCCAACTGGCCCTGCTGGTCCCCCAGGATTCCCTGGC
GGCCCTGGATCTAAGGGAGAGGTTGGTCCTCAGGGATCCC
GTGGTGCAGAGGGACCTCAGGGAGCCCGTGGTGAAGCTGG
TAACCCTGGACCTGCTGGTCCTGCTGGTCCCGCTGGTAAC
AACGGAGCTGATGGTGCCCCTGGTGCCAAGGGTGCTCCTG
GCGCTCCTGGTATTGCTGGTGCTCCTGGTTTCCCTGGACC
CCGTGGTCCTCCTGGAGCTGCTGGAGCGGCTGGTGCCCCT
GGCCCTAAGGGTAACACCGGTGAGGCTGGTGCCCCAGGTG
CCAAAGGAGAGGCTGGTGCTAAGGGAGAGGCTGGTGCCCA
AGGAGTTCAGGGTCCCCCTGGTCCCCCTGGTGAGGAAGGC
AAGAGAGGACCCCGTGGTGAGCCCGGTGCTGGTGGTGCCC
GCGGACCTACTGGTGAACGTGGTGCTCCTGGTGCTCGTGG
TTTCCCTGGTGCTGATGGAGCTGCAGGTCCAAGAGGTGCC
CCTGGTGAGCGTGGAGGCCCTGGAGTTGTTGGACCTAAGG
GTGCCACTGGTGAGCCTGGCCGCAATGGTGAACCTGGTAT
GCCAGGATCCAAGGGTATGACTGGTAGCCCTGGCAGCCCT
GGACCTGATGGAAAGACCGGACCTGGTGGTGCTCCTGGAC
AAGATGGCCGCCCTGGACCACCTGGCCCTGTTGGAGCCAG
AGGACAGCCTGGTGTCATGGGATTCCCTGGACCTAAGGGT
GCTGCTGGTGAGGCTGGCAAACCTGGTGAGAGAGGAGTGA
TGGGTGCTATTGGTGCCACTGGCGCTCCTGGTAAGGATGG
TGATGTTGGTGCCCCTGGTGCTCCTGGACCTGCTGGACCT
GCTGGTGAGAGAGGTGAACAAGGAGCTGCTGGTCCTCCTG
GATTCCAGGGTCTGCCAGGACCTCAGGGTGCTACTGGTGA
GCCAGGAAAGTCTGGTGAGCAGGGTGCTCCTGGAGAAGCT
GGAGCTCCTGGACCTTCTGGTTCTAGAGGTGACAGAGGAT
TCCCTGGTGAGCGTGGTGCCCCTGGCCCTGCTGGCCCTGT
TGGTGCCCGTGGTTCTCCTGGTTCAGCTGGTAACGATGGT
GCCAAGGGTGAAAGTGGTGCCGCAGGTGCTCCTGGTGCCC
AGGGTCCTCCTGGACTTCAAGGAATGCCTGGAGAGCGTGG
GGCTGCTGGCCTCCCTGGTCTTAAGGGTGACAGAGGTGAC
CAAGGTGCCAAGGGTGCTGATGGTGCTGCTGGTAAAGATG
GCATTCGTGGTATGACCGGACCAATTGGACCCCCCGGACC
TGCTGGAGCTCCTGGTGACAAGGGAGAATCTGGTGCTCAA
GGACTTGTTGGACCTACTGGTGCCCGTGGACCACCTGGTG
AGCGTGGAGAGACTGGTGCTCCTGGACCTGCCGGATTTGC
TGGACCTCCTGGTGCTGATGGTCTGCCTGGTGCCAAGGGA
GAACCTGGAGATAATGGTGCTAAGGGTGATGCTGGTGCTC
CAGGACCTGCAGGAGCAACTGGTGCCCCTGGACCTCAGGG
TCCCGTTGGTGCTACTGGACCCAAGGGTGCCCGTGGTGCT
GCTGGTCCTCCTGGTGCTACTGGCTTCCCTGGTGCTGCTG
GCAGAGTTGGACCTCCTGGCCCTTCTGGAAATTCTGGACC
CCCAGGACCTCCTGGACCCGCTGGTAAGGAGGGCCAGAAA
GGTAACCGTGGTGAGACTGGACCTGCTGGTCGTACTGGTG
AAGTTGGTGCTGCTGGACCACCTGGTGCCCCTGGTGAGAA
AGGAAATCCCGGAGCTGAGGGTGCCACTGGCCCTGCTGGT
ATCCCTGGACCTCAAGGTATTGGTGGTCAGCGTGGTATTG
TAGGTCTCCCTGGACAAAGAGGCGAGCGTGGTTTCCCCGG
TCTCCCTGGCCCATCTGGAGAGATTGGCAAACAGGGACCT
TCTGGTCCATCTGGTGAACGTGGACCTCCTGGCCCCATGG
GACCCCCTGGACTGGCTGGACCTCCTGGTGAGCCTGGTCG
TGAGGGTACTCCAGGAAATGAGGGCTCTGCTGGACGTGAC
GGTGCTGCTGGCCCCAAGGGTGACCGTGGTGAGACTGGCC
CATCTGGCACTCCTGGAGCCCCTGGACCTCCTGGTGCTGC
TGGACCTATTGGCCCTGCTGGAAAGACTGGTGATCGTGGA
GAGACCGGCCCTGCTGGTGTCCCCGGCCCTGCTGGCCCCT
CTGGTCCCCGCGGACCCTCTGGACCCGCTGGAGCTCGTGG
AGACAAGGGTGAGACTGGTGAGGCTGGTGAGAGAGGCATG
AAGGGACACAGAGGATTCACTGGAATGCCAGGACCCCCTG
GTCCTCCTGGACCCTCTGGAGAGTCTGGACCCGCTGGTGC
TTCTGGACCCGCTGGACCAAGAGGCCCAGCTGGATCTGCT
GGATCAGCTGGTAAGGATGGTATGAGTGGCCTCCCTGGAC
CCATTGGACCTCCTGGACCCCGTGGTCGCAATGGAGAAAT
TGGACCAGCTGGACCTCCTGGACCTCCCGGCCCCCCTGGA
GCACCTGGACCCTCTGGTGGTGGATTCGACATTGGCTTCA
TTGCCCAGCCACAGGAGAAGGCCCCTGATCCCTTCCGTCA
CTTCCGTGCCGACGATGCCAATGTGATGCGCGACCGTGAT
CTTGAGGTTGACACCACCCTTAAGTCCCTGAGCCAGCAGA
TTGAGAGCATCATCAGCCCAGACGGCACCAAGAAGAACCC
TGCCCGCACTTGCCGTGACCTGAAGATGTGCCACCCAGAC
TGGAAGAGCGGCGAGTACTGGATTGACCCTGACCAGGGCT
GCAACCAGGATGCCATCAAGGTCTACTGCAACATGGAAAC
TGGCGAGACTTGCGTCAACCCAACTGAGTCTGCTATTCCC
AAGAAGAACTGGTACACAAGCAAGAACATTAAGGAGAAGA
AACACGTCTGGTTCGGAGAGGCCATGACCGATGGCTTCCA
GTTCGAGTATGGCAGCGAGGGCTCCAAGCCTGAGGATGTC
AACATTCAGCTCACCTTCCTGCGCCTCATGTCCACTGAGG
CCTCCCAGAACATTACATACCACTGCAAGAACAGCATTGC
ATACATGGACCAGGCTTCTGGCAACCTGAAGAAGGCTCTT
CTCCTGCAGGGCTCCAACGAAATTGAGATCAGAGCAGAGG
GCAACAGCCGCTTCACATACAGTGTCACTGAGGATGGTTG
CACGTCGCACACCGGTGCATGGGGCAAGACAGTCATTGAC
TACAAAACAACGAAAACATCCCGTCTGCCTATTATTGACA
TCGCCCCTATGGACGTTGGTGCACCTAATCAGGAATTTGG
CATTGAAGTTGGCCCAGTCTGCTTCTTGTAAAAAAGAAAT
CTGGACTTGAGATTGTTTGTGTGCGTGTGTGTTTTTTTCT
AGCAATCATCTCTCTAAAATCTTTTCTATGCATTAAAATC
AAACCCTAGAATCCAATTTGGCTGTCCAAATGGTCCACTT
GCTTAGACCTGCGCTTCAGAAGACAGTGGTTGTGTGTTAT
CAGGCTTTTTTTGGACCACTATTTTGTCACCACCCACACT
GAGGATACTTTAGAAGACTCATTTGTTTCACTGGCAACAA
GAAAATAATATATACTTATAGCGTGTAAAATCCCCCTGGA
GTTTTAAAGAAACATCAATGATACAAGTGACTTTTTTCAA
CCACTGAGGAAGGACAATGAAAGAGCGAAACCAAATGCTT
TGTACCATGTTCAGGTGTTAAATAAATCTGTAAAATGACA
TTTAAGTGTCTCTGTGTTATACCCATTAGGACCACCGGGT
GCCGAATGCCAACGTTCCTCTCAAGTCACACGAGTACATC
TAGTAGAGACAGGGGTTCAACTTTGTTTTGATGTTTTATG
GCTACCTCAAAAAAGAAACCTGCGATTCCCAGTGTTGACC
AACACCAGGTCAGGATTTTACTTGGCAGAAGTATTGTTAA
GAGAACAAGTGACAGCTGTAAAGGTGCTATTTCCTCATGA
GGTCCTGTTAGCAAGAAATCAAGGAGTTTCACAAAATGTA
TTGTTCGTCGCTTTTGCTCACAGGGCCTTTGGTGCTAAGG
AACCCCAGCATCTTGCTGCCCAGTTGTAACAGATGCTTCC
CTTTCTGAAGTGAAGAGCCAGACAGCAGAGCTTTTGTTAA
AAAGCAGTACTGTAGCTGTGATGCATGCAGTCTTTTCAAG
TGTAGAATAAGCAGGTGGAGTCTGTTTTTATTTTCCAAAC
GCCTTTTGACACTTTTTGGTTGTTGTCTTTTGGTTTCTTT
ATAAAATATCCCCCCACAAATGTCGTTCAGTTGCTTCCAG
CTATTCCCCCTACTTCCCTCCCATCCTTCTGTAATCTGGA
TTTGTTTTGTTCTCACCCTGGTTTTTTTTTTTAAGCGTAA
AACAGACAATCAAATAGAAAAGTCCTAAAATCATGAGAGA
AGCACACCTTAGGGGGGTAAAAACAAGAAGATCTGTACCT
ATTTTGTATATGTATAATAATTTGAGATGTTTTTAATTAT
TTTGAATGCTGAAATAAAGCATGTTAAGTGGTCGACCTAT
GTTTGTCAGAAGTGATCTTGACTCGTCCCTGACTGCCCAA
TGGACTTGAATGAAGCACAGCTTGCACCTGTTACAGTTGT
TTTGACTAAAAGGAAAGATTAAAGAAAATCTCAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations