Transcript

kri1-003

ID
ZDB-TSCRIPT-090929-7173
Name
kri1-003
Previous Names
  • kri1l-003
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024305 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024305|OTTDARG00000019708|ZDB-GENE-040915-3 kri1|no_translation flj12949l-003 LG_ BX322663.8 Danio rerio protein_coding KNOWN, 787 bp
GGCCAGTATCATGCGTCTCTACACTGTCTGTCATCGGTCG
AACATACAGAAAATGTTTCAGCCTACACAAACCCCATTTG
TTCCCCTGTTTCCAGACGAGAAGAGCTTCGAGCAGTACTT
GGACGAGTACTATAAACTGGACTTTGAGGACATCATTGAT
GACCTGCCGTGCAGATTTCGCTACCGAGAAGTGGTAGCCA
ATGACTTTGGGCTGAGCACTGATGAGATTCTGAATGCAGG
TGATAAGGAGTTGAACCGCTGGTGCTCACTAAGGAAGACC
TGCATGTACAGGTCAGAAAGGGAGGAACTCTGTGACCTGA
AGAACTTCCAGATAAAAGCACGCAATGTCAAGAAGAAACA
GCAAGTGTTCGTGTCTTTGTTTAATGAAAATGATGGTCAG
GAGGAGCAAAAGGATACCAAGGGGAAGGTGGGAAAGAAGA
GGAGGGATCGTCTAAAGAAAGCCGAGCTCACGGAGAAGAG
CGACACCACTGTGACTGAAGAAACAGCTGAACCTCCTCCA
GCAGAGCAAGCAGATGTCCAGGACCTCAAAGCGACCATCG
CAAATGATGAAGAGGAGGATGACGAGGAGTTCCTGGTTCC
TAAGAAAAAGATGAAGACGGCAGAGACTGTGGTAACCAAG
AGGAAAGAGGCAGATGTTGAAAGAACTGAAAAACCCAAAA
GACCCAGAAAGAAAATGCGTCGCTCAGGTGGACGGCGGCA
GCTGAAGTCCATGACGGTGAAGATGGCCGGTCGAGAATTC
AGCAGACAGAGACTACAAGCCTACGGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations