Transcript

kri1-202

ID
ZDB-TSCRIPT-090929-7171
Name
kri1-202
Previous Names
  • kri1-001
  • kri1l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024303 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024303|OTTDARG00000019708|ZDB-GENE-040915-3 kri1|OTTDARP00000020092 flj12949l-001 LG_ BX322663.8 Danio rerio protein_coding KNOWN, 2777 bp
ACTTTTCAGGACATGTGTTACTCACTCGCGGCAACAAAAG
CTGCTTGTTTTTATCACAGACTCCAAAAAAAAAATCGTTC
TAAATATATGACAGAAAGGACCGGTTTAATTTCTAACAAG
GAGTAAAATGTTAGTAGAAAAACAATCGACGAAAGGAGGC
GATAGTTGAACCCTGAACTATATGACGTAGGAGAGGGTCG
TAGGTCACGTGCCCATGCCGTACAGCAGAGCAACATGTCC
AACGTGAGAGTTTGAATTATCGAGATATTAATCTGATCTC
AAATCAGAAGATACCGCACAGTTATACGACAACATGTCGG
ATCTCAAGATTAACAAGAAGTTTGCAGAGAAGTATGAGAA
ATATCGCCAGAAAGAGGAACTGCAGAGACTGAAGGACCGT
TATGGAGACCAGGAAGAGGAAAATTCATCAAACTCCTCCG
AATCTGACTCTGATGACAGTGAAGTGGAGCTGGATCCAAA
GCTAGACAGAGATTTTTACAGAACTCTCTCGCTTCTGAAG
AAAAAGGATCCAAAGATCTATCAGAAAGATGCCAAATTCT
ACACAGAAGAAACATCTGGGTCAGGCAGCGATGAGCAACC
GTCCACTTCGAAACAGTCAGAGAAACCCATGTTCCTTAAG
GACTATGAGAGGAAAGTCATCCTGGAGAGAGGAGGAAAAT
ATGAAGACGATGACAGTGCTGATGAAGAAATCTCCGCAAA
GATGCAGGAGAGAGCTGCATCTCCCACATACATCCAGGAG
CAAAAGGAGATACAGGAAAGTTTGCGCAAGTTTGTTCAAG
ACAGTGATGATGAGGACAGTGATGGTGACGGACAGTTTTT
GACACGGAGGACCAAAACACAAGAGGAAAAAGACAAAGAG
GAAGCTGACTATGTGGAATGGCTGAAGGGTCAAACAGAGC
TGGATGAGAAAGAAGAACTTAAGGACATGAAATATCTGCG
GGACTACTGGAACAATCCTCAGTTAGATGAGAAAGAGTCT
TTCCTGCGGGACTTCATGCTCAACAAGGGCTACATGGAGG
AGGAGGATGAAGAGAGGATCCCCACATATAATGAGCTCAT
GCAGGATGATGTGGATGATTCTGAGGATGAAGGAGAATCA
TTTCTGCATAAACAGGAAGACTTTGAGAGGCATTACAACT
TCCGCTTTGAGGAGCCTGATGCTGGAAAAGTCAAAACATA
TCCCCGCAACATTGCAACTTCTGTCCGCAGCAAAGACGAC
AGGAGAAAGAGGAAGAGAGAAGAGGTTAAAGAAAGGAAGA
AGAAGGAGAAGGAACAGAAGCAGCAGCAGTTGAAGGAACT
GAAGAACCTAAAGCGAGCAGAGATCATGGATAAACTGAAA
AAACTGCAGGAGCTAACTGGAAATGAACAGCTAGCCTTCA
ATGATGTTGACCTGGACGGAGACTTTGACCCTCAGCAACA
CGACCAGCTTATGCAGAAGGTCTTTGGTGATGAATACTAT
GAAGAGAATGAAGAAGAAAAACCACAGTTTGAAGGCGATG
AGGAATTTGAAGAAAATTGGAACTGGGATACATGGGTGGG
AAAACAGCAGAATGAGGAAGAGTATGACCACAAGGAAGAC
TATACTGCGGAGGAACACTACCAGCCCAACTGTGATGATC
CTGACTTTATCATGGATGCTGATTACGACCCAAGCCAACA
GGCCGTTTCTAAAAAGAAAAGAAAAAAAGAGAGAGAGGAG
AAGAAAAAGAAGAGCAAAGAGGACGTCCCACTCATGGGAA
AGAAGAGGAAAAAGTCCCACTTTGCAGAGATCATCAGCAA
AAGCAAGCCTGTCTTTGATCCAAACGAGAAGAGCTTCGAG
CAGTACTTGGACGAGTACTATAAACTGGACTTTGAGGACA
TCATTGATGACCTGCCGTGCAGATTTCGCTACCGAGAAGT
GGTAGCCAATGACTTTGGGCTGAGCACTGATGAGATTCTG
AATGCAGGTGATAAGGAGTTGAACCGCTGGTGCTCACTAA
GGAAGACCTGCATGTACAGGTCAGAAAGGGAGGAACTCTG
TGACCTGAAGAACTTCCAGATAAAAGCACGCAATGTCAAG
AAGAAACAGCAAGTGTTCGTGTCTTTGTTTAATGAAAATG
ATGGTCAGGAGGAGCAAAAGGATACCAAGGGGAAGGTGGG
AAAGAAGAGGAGGGATCGTCTAAAGAAAGCCGAGCTCACG
GAGAAGAGCGACACCACTGTGACTGAAGAAACAGCTGAAC
CTCCTCCAGCAGAGCAAGCAGATGTCCAGGACCTCAAAGC
GACCATCGCAAATGATGAAGAGGAGGATGACGAGGAGTTC
CTGGTTCCTAAGAAAAAGATGAAGACGGCAGAGACTGTGG
TAACCAAGAGGAAAGAGGCAGATGTTGAAAGAACTGAAAA
ACCCAAAAGACCCAGAAAGAAAATGCGTCGCTCAGGTGGA
CGGCGGCAGCTGAAGTCCATGACGGTGAAGATGGCCGGTC
GAGAATTCAGCAGACAGAGACTACAAGCCTACGGGCTCAA
TCCAAAGAGACTCCACTTCAGAGAGCTGTACAGACAGAAA
CGGAAAGAGCGAGAGAAACAGGAAAAGCAGCAGAAGAAGA
GCAAACAGTGATGCTGGAAATCAACACCATTTTGATTGAG
CTGTTTTTAAGGGACCAGGAACCGCTGAAAATAGGAAATT
GCATTATTAACATGTTCATTTCAATCTTGAAAGTTTCTGA
ATCATTGCTGAAAGCTTTCTCTGTTTTTCTTTTTTAATTA
AAAGAGTTTTTGTGGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations