Community Action Needed: Please respond to the NIH RFI
Transcript

kcnip3b-002

ID
ZDB-TSCRIPT-090929-7107
Name
kcnip3b-002
Previous Names
  • kcnip3-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024224 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024224|OTTDARG00000019660|ZDB-GENE-040426-1752 kcnip3b|no_translation csen-002 LG_ BX548043.5 Danio rerio protein_coding KNOWN, 598 bp
GGCAGATGGACAGAAGGGCGTCGATGGAGGTCTGCTTCCT
GATGCCAACGGGCGGGATGGGGACTCCAGCGGGCAGAAGG
AGAGCGACGGGAAGTGGCAGAAACCACGCATCACCCGCAA
ATCCCTCATGAAATGCTGTCTGGTCAAATGGATCATCGCC
AGTGCGGCGCCTCAGGGCTCAAACAGCACTGACAGTGAGC
TGGAACTGTCCGCTGTTCGCCATCAGCCTGAGGGTCTAGA
GCAGCTTCAGGCTCAGACTCAGTTCACCAGGAAGGAGCTG
CAGTCGCTTTACAGAGGCTTCAAAAATGAGTGTCCCAGTG
GACTGGTGGACGAGGAGACCTTCAAATCCATCTACTCCCA
GTTCTTCCCTCAAGGAGATGCGACCACATATGCACATTTC
CTTTTCAATGCCTTTGACATGGACAGAAATGGCTCAATAC
GATTTGAGGACTTTGTAATCGGCCTGTCTGTTCTGCTTCG
AGGTTCGGTGACGGAGAAACTGAGATGGGCCTTCAACTTA
TACGACATTAACAAGGACGGCTACATCACCAAAGAGGAGA
TGTTGGCTATCATGAAGTCTATCTATGATATGATGGGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations