Community Action Needed: Please respond to the NIH RFI
Transcript

kcnip3b-202

ID
ZDB-TSCRIPT-090929-7106
Name
kcnip3b-202
Previous Names
  • kcnip3-001
  • kcnip3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024223 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024223|OTTDARG00000019660|ZDB-GENE-040426-1752 kcnip3b|OTTDARP00000020035 csen-001 LG_ BX548043.5 Danio rerio protein_coding KNOWN, 1158 bp
CCAAAGCAGACAGTGAATGAGAGCGAACATCTGAGGATCC
CTCATTCATTCGGTCATCAAAACAGACGCCAGGAACAACA
TGCAGGCAGATGGACAGAAGGGCGTCGATGGAGGTCTGCT
TCCTGATGCCAACGGGCGGGATGGGGACTCCAGCGGGCAG
AAGGAGAGCGACGGGAAGTGGCAGAAACCACGCATCACCC
GCAAATCCCTCATGAAATGCTGTCTGGTCAAATGGATCAT
CGCCAGTGCGGCGCCTCAGGGCTCAAATGACAGCACTGAC
AGTGAGCTGGAACTGTCCGCTGTTCGCCATCAGCCTGAGG
GTCTAGAGCAGCTTCAGGCTCAGACTCAGTTCACCAGGAA
GGAGCTGCAGTCGCTTTACAGAGGCTTCAAAAATGAGTGT
CCCAGTGGACTGGTGGACGAGGAGACCTTCAAATCCATCT
ACTCCCAGTTCTTCCCTCAAGGAGATGCGACCACATATGC
ACATTTCCTTTTCAATGCCTTTGACATGGACAGAAATGGC
TCAATACGATTTGAGGACTTTGTAATCGGCCTGTCTGTTC
TGCTTCGAGGTTCGGTGACGGAGAAACTGAGATGGGCCTT
CAACTTATACGACATTAACAAGGACGGCTACATCACCAAA
GAGGAGATGTTGGCTATCATGAAGTCTATCTATGATATGA
TGGGCAGATACACTTCTCCTTGTGTCAAAGATGACGCTGC
TTTTGAACATGTGGAGAAATTCTTCCAGAAAATGGACCGA
AACAGGGACGGTGTGGTGACCCTTGAGGAGTTCATCGAGA
CCTGTCAGAAGGACGAGAACATCATGAGCTCCATGCAGCT
GTTTGAGAACGTCATCTAGAGCTCAGCATGAATGATCCTC
CATCAAACTCTCTTCACACACACACACAGACACTTGTGTT
TTCTGTTATCTCCAGCATGTGAATGAGTCTTTTGATTGAT
TGTAATGAATGCTGTGCACAGTTGTCTGCGAGAGGGGATA
CTGCAGTATGTTGCCGTTTCGATGCTCATTTGTATATATG
TAGATAATGTCTGTGCTCTTCAGTTTCTGCCTGGTTTAAT
GAACGTTCGCATGTTTGCCTGCTGTTTGTCTGAGCCGTTG
TCATTTTGTACAAAGGAATAAAGGCAAATGTGAATGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations