Transcript

cltca-002

ID
ZDB-TSCRIPT-090929-6987
Name
cltca-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024100 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024100|OTTDARG00000019582|ZDB-GENE-030131-2299 cltca|no_translation cltc-002 LG_ CR392341.14 Danio rerio protein_coding KNOWN, 747 bp
GGACCCAGAGGAGGTGTCAGTCACAGTGAAGGCCTTCATG
ACTGCTGACCTGCCCAATGAACTCATTGAGCTGCTGGAAA
AGATTGTCCTGGACAACTCCGTCTTCAGTGAACACAGAAA
CCTGCAGAACCTGCTCATCCTAACAGCCATCAAAGCTGAC
CGTACTCGGGTCATGGAGTACATCAACCGCCTGGACAACT
ACGATGCCCCAGACATCGCCAACATCGCCATCAGCAGCGA
GCTGTTTGAGGAGGCCTTCGCCATCTTCAAGAAATTCGAT
GTCAACACCTCTGCAGTGCAGGTTCTGATCGAGCACATTG
GTAATCTGGACCGGGCCTATGAGTTTGCGGAGCGCTGCAA
TGAACCTGCGGTGTGGAGTCAACTGGCCAAGGCTCAGCTT
CAGAAGGGTCTCGTCAAAGAGTCCATCGACTCCTACATCA
AAGCTGATGATCCTTCAGCTTACATGGAAGTGGTCCAAGC
TGCTGACCAAAGTGGTGAGGCCTTTATCTAGTTCTCATTT
TACATTTAGATGACTTTTCCCTCCCTCTGATTCTGTTGTT
CATGACTTTATCACTTTGCTCAGGAAACTGGGAGGACCTG
GTGAAGTTTTTGCAGATGGCCAGAAAGAAGGCCAGAGAGT
CTTACGTGGAGACTGAGCTGATCTTCGCTCTGGCCAAAAC
CAACCGTCTCGCTGAACTGGAGGAGTTTATCAATGGACCA
AATAATGCACACATCCAGCAGGTTAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations