Transcript

cltca-201

ID
ZDB-TSCRIPT-090929-6986
Name
cltca-201
Previous Names
  • cltca-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024099 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024099|OTTDARG00000019582|ZDB-GENE-030131-2299 cltca|OTTDARP00000019942 cltc-001 LG_ CR392341.14 Danio rerio protein_coding KNOWN, 6443 bp
GAGTTCCTCTCAGCGGCGGTTGACATTCTGGAGTTGAAGC
GCCTCATTTATATTCAACGGGCGACTAGAGAAACCTAACA
CATTCCCGGTTCATCTGCCCCCTCCCCAAAAAAACACCAG
ACCACCTCCATTCATCCCCGGCTCTGGAGTAGTTTAGATA
AGGCAGAACTAATAGCAGGAATTAGAGAGCAAATCGAAGA
GGAACCACCACCACCATCATGGCTCAAATCCTGCCCATCA
GATTCCAGGAGCACCTGCAGCTCCAAAATTTGGGGATCAA
CCCAGCCAACATTGGGTTCAGCACCCTGACAATGGAATCG
GATAAGTTCATCTGTGTCCGGGAGAAGGTTGGAGAACAGG
CGCAGGTGGTGATCATTGATATGGCGGACCCAAACACCCC
CATCCGCAGGCCCATCTCTGCAGATAGTGCCATCATGAAC
CCTGCGAGCAAAGTCATTGCCCTCAAAGCTGCCAAAACCC
TTCAGATCTTTAATATCGAGATGAAGAGTAAGATGAAAGC
CCACACCATGACCGATGACGTTACTTTCTGGAAGTGGATC
TCCCTCAACACTGTTGCCCTCGTGACCGATAACGCCGTCT
ATCATTGGAGCATGGAGGGAGACTCTCAGCCGGTCAAAGT
GTTTGACAGACATTCCAGTCTGGCAGGCTGTCAAATCATC
AACTACCGCACTGATGCCAAGCAGAAGTGGCTGCTGCTCA
TTGGCATTTCTGCTCAGCAAAACAGAGTTGTTGGAGCCAT
GCAGCTCTACTCTGTTGATAGGAAGGTGTCACAGCCTATT
GAGGGGCACGCCGCTGGCTTTGGTCAATTCAAAATGGAGG
GAAACACTGAAGAATCCACTCTCTTCTGTTTCGCTGTGCG
AGGTCAGGCAGGCGGAAAGCTTCACATTATTGAAGTGGGC
ACACCACCAACAGGCAACCAGCAATTCCCAAAGAAAGCCG
TGGATGTGTTCTTCCCACCAGAAGCACAGAATGACTTCCC
TGTAGCCATGCAGATCAGCTCCAAACATGATGTTGTGTAT
CTCATCACTAAATATGGCTACATTCATCTGTATGACCTGG
AGACGGGCACCTGCATCTACATGAACCGAATCAGCGGGGA
GACCATTTTTGTGACTGCGCCCCATGATGCCACAGCTGGG
ATTATCGGCGTCAACAGGAAAGGACAGGTGTTGTCAGTGT
GTGTTGAGGAGGAAAACATCATCCAGTACATTACCAATGT
GCTGCAGAATCCAGACCTGGCTTTACGGATGGCAGTCCGC
AATAATCTGGCTGGAGCTGAGGAGCTGTTCGGACGCAAGT
TTAACAACCTCTTTGCCGGTGGAAATTTTGCAGAGGCAGC
TAAAGTAGCTGCTAATGCTCCAAAGGGTATCCTGCGCACC
CCTGACACCATACGCCGGTTCCAGAGTGTCCCGGCTCAAC
CAGGCCAGACGTCCCCACTGCTGCAGTATTTTGGGATCCT
CCTGGACCAGGGCCAGCTCAACAAGTTTGAGTCTTTGGAG
CTCTGCAGACCCGTCCTTCAGCAGGGCCGCAAACAACTGC
TGGAGAAATGGCTGAAGGAGGACAAGCTTGAATGCTCAGA
GGAGCTGGGTGACCTGGTGAAGTCTGTGGACCCGACTCTT
GCTCTCAGCGTCTATCTGAGGGCCAACGTACCCAACAAAG
TCATTCAGTGTTTTGCAGAAACTGGCCAGTTCCCTAAGAT
TGTCCTGTACGCCAAAAAGGTGGGCTACACTCCAGACTGG
ATCTTCCTGCTGAGGAACGTGATGCGGATCAGTCCAGATC
AGGGTCTGCAGTTTGCTCAGATGCTTGTTCAGGACGAGGA
ACCGCTGGCTGACATCACACAGATCGTTGATGTGTTTATG
GAGTATAACCTGGTCCAGCAGTGCACTTCCTTCCTTTTAG
ATGCTTTGAAGAACAACCGGCCATCAGAAGGACCACTGCA
GACCCGTCTGCTGGAGATGAACCTGATGCACGCACCACAG
GTTGCAGATGCCATCCTAGGAAACCAGATGTTCACCAACT
ACGATCGTGCCCACATCGCCCAACTGTGTGAGAAAGCAGG
ACTTCTTCAGAGAGCTTTAGAGCATTACACCGACTTGTAT
GACATCAAACGAGCTGTCGTGCACACACACCTGCTCAACC
CGGAGTGGCTGGTCAACTACTTTGGCTCTCTGTCAGTGGA
GGACTCTCTGGAGTGTCTGAGGGCCATGCTGTCTGCTAAC
ATCAGACAGAATCTCCAGATCTGCGTCCAGGTGGCGTCCA
AGTATCACGAGCAGCTGAGCACACAGTCCCTCACCGAGCT
CTTTGAGTCGTTCAAGAGTTTTGAGGGCCTTTTCTACTTT
CTTGGCTCAATCGTAAACTTCAGCCAGGACCCAGAGGTGC
ATTTCAAATACATCCAGGCCGCATGCAAGACGGGCCAAAT
CAAAGAGGTGGAGCGCATCTGTCGGGAAAGCAACTGCTAC
AACCCTGAACGTGTCAAGAACTTTCTCAAGGAAGCTAAAC
TCACTGACCAGCTGCCTCTCATTATTGTGTGCGATCGCTT
CGACTTCGTCCACGACCTTGTTCTTTACCTGTACAGAAAC
AACCTGCAGAAGTACATCGAAATCTACGTCCAGAAGGTAA
ACCCAAGCCGTCTGCCTGTGGTGATTGGAGGTCTGCTGGA
TGTGGACTGCTCTGAGGATGTCATCAAAAACCTGATCCTG
GTTGTACGGGGACAGTTTTCCACCGATGAGCTGGTGGCAG
AAGTGGAGAAGAGAAACAGACTGAAGCTGTTGTTGCCCTG
GCTGGAGTCTCGTATCCACGAGGGCTGTGAGGAGCCAGCT
ACCCACAATGCCCTGGCCAAGATCTACATCGACAGCAACA
ACAACCCTGAACGCTTCCTGCGGGAGAACCCATACTACGA
TAGCCGCGTGGTGGGGAAATACTGCGAAAAACGAGACCCT
CATCTGGCCTGTGTGGCCTATGAGAGAGGAACGTGTGACC
AGGAGCTGATCAACGTTTGCAATGAGAACTCGCTGTTCAA
GAGTTTGTCCCGCTATCTGGTGCGCCGCAGGGACCCTGAG
CTATGGGCCAGTGTGCTTCTGGAGACCAACCCCTTCAGGA
GGCCCCTTATTGACCAGGTGGTGCAGACAGCCCTGTCAGA
GACTCAGGACCCAGAGGAGGTGTCAGTCACAGTGAAGGCC
TTCATGACTGCTGACCTGCCCAATGAACTCATTGAGCTGC
TGGAAAAGATTGTCCTGGACAACTCCGTCTTCAGTGAACA
CAGAAACCTGCAGAACCTGCTCATCCTAACAGCCATCAAA
GCTGACCGTACTCGGGTCATGGAGTACATCAACCGCCTGG
ACAACTACGATGCCCCAGACATCGCCAACATCGCCATCAG
CAGCGAGCTGTTTGAGGAGGCCTTCGCCATCTTCAAGAAA
TTCGATGTCAACACCTCTGCAGTGCAGGTTCTGATCGAGC
ACATTGGTAATCTGGACCGGGCCTATGAGTTTGCGGAGCG
CTGCAATGAACCTGCGGTGTGGAGTCAACTGGCCAAGGCT
CAGCTTCAGAAGGGTCTCGTCAAAGAGTCCATCGACTCCT
ACATCAAAGCTGATGATCCTTCAGCTTACATGGAAGTGGT
CCAAGCTGCTGACCAAAGTGGAAACTGGGAGGACCTGGTG
AAGTTTTTGCAGATGGCCAGAAAGAAGGCCAGAGAGTCTT
ACGTGGAGACTGAGCTGATCTTCGCTCTGGCCAAAACCAA
CCGTCTCGCTGAACTGGAGGAGTTTATCAATGGACCAAAT
AATGCACACATCCAGCAGGTTGGAGATCGCTGCTATGATG
AGAAGATGTACGAGGCGGCCAAACTTCTCTACAATAACGT
CTCCAACTTCGGCCGCTTGGCTTCCACTCTGGTCCACTTG
GGCGAGTATCAAGCCGCTGTCGATGGTGCCCGCAAGGCCA
ACAGCACTCGCACATGGAAAGAGGTTTGCTTTGCCTGTGT
GGATGGAAAGGAGTTCAGATTGGCTCAAATGTGCGGCCTT
CATATCGTGGTTCACGCAGATGAATTGGAAGAGCTCATCA
ACTACTATCAGGACCGTGGCTACTTTGAGGAGCTGATCAC
CATGCTGGAAGCGGCGCTGGGGTTGGAGCGCGCTCATATG
GGCATGTTCACAGAGCTCGCCATCCTCTACTCCAAATTCA
AGCCACAGAAGATGAGGGAGCACCTGGAGCTCTTCTGGTC
CAGAGTCAACATCCCAAAGGTTTTGAGGGCTGCAGAGCAG
GCTCACCTGTGGGCAGAACTGGTTTTCCTGTACGACAAGT
ATGAAGAGTTTGATAACGCCATCATCACCATGATGAGCCA
TCCCACAGACGCCTGGAAAGAGGGACAGTTCAAGGACATC
ATCACCAAGGTGGCCAATGTGGAACTGTACTACAAAGCCA
TCCAGTTTTATCTGGAATTCAGGCCCTTGTTACTGAACGA
CCTGCTCATAGTTCTTTCTCCAAGACTCGATCACTCGCGA
GCCGTCAACTTCTTCAGCAAGGTTAAGCAGCTTCCTCTGG
TCAAGCCTTACCTGCGGTCAGTACAAAACCACAACAACAA
GTCAGTCAATGAAGCACTTAACAACCTCTTCATCTCAGAG
GAGGACTATCAGGCCCTCAGGACGTCCATAGACGCGTACG
ATAACTTCGACAACATCTCTCTGGCTCAGCGTCTGGAGAA
ACACGAGTTAATTGAGTTCAGGAGAATCGCTGCTTACCTC
TTCAAGGGGAACAACCGCTGGAAGCAGAGCGTGGAGCTGT
GCAAGAAAGACAAGCTCTACAAGGATGCCATGCAATATGC
ATCGGAGTCAAAGGACACAGAGCTGGCCGAGGAGCTGCTG
CAGTGGTTCCTGGATGAGAATAAGAAGGAGTGTTTTGCCG
CCTGCCTCTTCACCTGCTACGATCTGCTCCGGCCTGACGT
GGTGCTGGAGACATCCTGGAGGAACAACATCATGGACTTC
GCCATGCCGTACTTCATCCAGGTCATGAGGGAATACCTCA
GCAAGGTGGACAAGCTAGAGACCTCTGAGTCCTTGAGGAA
AGAGGAGGAGCAAGCGACAGAAACTCAACCAATTGTTTAT
GGCACACCCCAGCTCATGCTGACAGCAGGCCCCAGTGTGC
CCGTCCCACCACAGCAGGGGTATGGCTATGGTTACACAGC
AGCTCCTGGTTATCCCCCTCAGGCTCCTCAGGCCCAGCCG
GGCTTCGGTTATGGCATGTAAAGAGCTCCCCGTCTCCCGC
TCGCCTCTCTTCCTGCTGCCGCTTGGTTCGGTCCAGCAAA
CCCCATGGATCTCCCTCAGTCCTCCACCAGTCCGACTCTA
CCACTTTGTGCTCACGACGGGGGATTTGAGCAAATGTCAT
TCTTTTACTTTACCTTTTGTTTATTTTTTTTTTAAATGAT
CGTTTTTGTTTATCGTGTTTTCTTTATACCATCATGAAGG
ACTTTATTTCTATGTTGTCAAAGATTTCATTGCGAGTAAT
TTTTTGTCACATTCCAGATGTCTACTAGAGTTAATTTCTT
GTCAGTTTTATCTGTCAGTTTAAAGGGGAAGGGCGTCTGT
GTTGAGGAGACTTGTGGGAAAATAGCAAGTCAGCAGCTTC
ATTAAAAATGACTAAACAAAATCTGATTTGCACTCCGTGG
TCTGAGAAAAACAACTAATGTATCATTTCTCTGTGTGTGT
GTGTGAGCAACTTGTTCAGTCCGTCTGCATTTATCTATTG
TATATTCCAGGAAACAGAAAATAAAATGGAGGAAACTGTT
TGACTGCCGCCTCCACAAACAAACACTACTCGATACCAGT
AATTCAGTGGGGGGGTGAGTAGCAATTAATATATGTTTAA
AAAGGGTTGTTTAAATGCGTTACGACACGTTCAAGTTGAC
CTATGCAGGTTTTCCGGTTCCTCTGTTTTTCCACAAACTT
TTGTTGTGCAGTAACCCGTGCTCATTGTCTGGGACCATCC
ATTTAAAGGAGGGATGATGATTAAAATATATAAATATATA
TAGAAATATATACGCGGCTCTCCACACCTCTGTGTGTTTT
ACTAACCTGACCTCTCTGTGCTGCAGTGTGTATGTGTGTG
TATGCTGGTTGTTGTGATGTTTCAGTCACTGTATGGCATC
GAAGTGAGACTAGAGAAAGCCAGTTGATCCTGCCAGTTAT
TCCTAAACTCAAGAGTTTACCCTTTATTTGTAAAGAAGAG
AAATCACCAATTGGGTTTATGAAGATTTAAACTAACTTCC
GTGTGTGTGCGCGTGTGTCCTGTACTCGGTTTTCACTGAG
TTGAGATTAATCATACATGTACACTTCTATTGTAGTGATC
TGATTGTGCACAAAGAGAATGAGACTTCTTTCTTCCCCTC
CAGATTACCATAAAAATAAAGGCTTCTTGTTTGTCAAGAA
AAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations