Community Action Needed: Please respond to the NIH RFI
Transcript

cryaa-201

ID
ZDB-TSCRIPT-090929-6868
Name
cryaa-201
Previous Names
  • cryaa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023929 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023929|OTTDARG00000019471|ZDB-GENE-020508-1 cryaa|OTTDARP00000019820 cryaa-001 LG_ BX248514.3 Danio rerio protein_coding KNOWN, 1417 bp
AAGGCCGGCACACATCATTTGGGGATCTTTGTACTGTACT
AGCCTCTATTAGCCTCCTACTTGCGTTCAGTTCACATCTT
TTGTTCATCAGGTGCAATAAGTTACAGTAAGGAGTTACCA
GGTCTGACATTATGGATATTGCGATCCAACACCCTTGGTT
CAGACGCACACTGGGCTACCCCACCCGACTCTTTGATCAG
TTCTTTGGAGAAGGCCTGTTCGATTATGACCTATTCCCCT
TCACCACTTCAACTGTCAGCCCTTACTATCGACACTCACT
CTTCCGCAACATCCTGGACTCCTCCAACTCAGGTGTCTCT
GAGGTGAGGTCTGACAGAGAAAAATTTACAGTTTATCTGG
ATGTGAAACATTTCTCTCCTGATGAGCTCAGTGTCAAGGT
GACAGATGACTATGTGGAGATCCAGGGCAAGCATGGAGAA
AGACAGGATGATCATGGCTACATCTCCCGTGAGTTCCATC
GTCGCTACCGCCTGCCTTCCAATGTGGACCAGTCTGCCAT
CACCTGCACACTGTCTGCTGATGGCCTGCTCACTCTTTGT
GGACCCAAGACAAGTGGCATAGATGCTGGCCGTGGAGATC
GCACCATCCCTGTTACCCGCGAGGACAAGAGCAACTCAGG
CTCTTCCTCCTAGACAGGCTGAACCCACAGCCAGGTGGTG
GTATGGAGGTGTGAGTGGGGCTGAATGGGGGGCCTAGGCT
TTAATTTCAGAGGGCATCTAAAGGTGGATTCAAGCAAATC
CTCTATTTGTTTATCACTAAGCAAGTCCCTCCTCCCACCT
CCGGGTGTCAGTGTATATCTGGCCCTTTATTCTTTCATTT
GACTACACTAGCTAATAATCTTCATAATCCACTATGATTG
TTTTATTTTTTCCTTATATGCTACTCACACAGGAAATGGA
CCAGGCTGATTGGATGACAGTCACAATATCATTTCGTATA
TATATATATATATATATATATATATATATATATATATATA
TATATATATATATATAAGCATCTGTCCCACTTTCCAGTCG
GCAGTTAAGTGACAAGCAATTCTGAATTCTACAAGCTTCT
GATTTTGACCAACCTGGTGACAGAGTAAAAGTGATCATTA
TTTAAATGCATATTTCTTTTGCTGTAGAGAACACATAGTT
CTGAGAAGGGATGTCAACAGGGGTTTAAGAGCTTATTTAA
AAAAAAAAATTTCTGTTTGACGACTTAATCCAAAAGAGAT
TTTATAACTGGCACCAGTCAAACCTCCGCTTTCTCCCTAA
CCTGTGTCAAGACCTCTTTTGTCATCGACTCTTTCTCGTC
TTGTAGGGTTAGCCTTGTTCTACTGATTACTGACTCCACA
TGGGGCCATAAAAAGTGATCAAAGATAATAAAGATGTAAC
CTTAACCTTTCAGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations