Transcript

tbc1d9-203

ID
ZDB-TSCRIPT-090929-6788
Name
tbc1d9-203
Previous Names
  • tbc1d9-001
  • si:ch211-199c19.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023837 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023837|OTTDARG00000019416|ZDB-GENE-060810-33 tbc1d9|OTTDARP00000019757 tbc1d9-001 LG_none BX957281.8,AL935166.14 Danio rerio protein_coding KNOWN, 4072 bp
ATGTGGGTGAACCCTGAGGAGGTGCTGTTGGCCAGCGCGT
TATGGATGACAGAGAGAGCCAATCCGTATTTCGTCCTGCA
GAAGAGAAAGGGCCACGGGGACGGCGGAGGAGGACTCGCG
GGACTGCTGGTTGGGACCCTTGACGTTGTGCTTGACTCCA
GTGCCCGTGTGGCCCCGTACCGAATCCTCTACCAGACTCC
TGATTCCCTGGTCTACTGGACCATCGCTCACGGGAGTTCT
CGAAAGGAGATCACAGAGAATTGGGAATGGCTGGAGCAGA
ACCTGCTGCAAACTCTGTCCATCTTTGAAAATGAGAACGA
CATCACCACCTTCGTCAAGGGCAAAATACAGGGCATTATA
GCCGAATACAACAAAAGCCATGACATCAAAGAAGACGACG
ACACAGACAAGTTCAAGGAGGCCATCGCTAAGTTTCGCAA
GCTGTTCGTGATGCCGGAGGAGGAGAAGCTGGTCAACTAT
TACTCCTGCAGCTACTGGAAGGGGAAGGTGCCACGGCAGG
GCTGGCTTTACCTCAGCATCAATCATATATGCTTCTACTC
ATACCTGCTCGGAAAAGAAGTGAAGCTGGTGGTCCGCTGG
GCAGATGTGACTCAGCTGGAGAAGAGCGCCACCCTCCTGC
TGCCGGATATGGTGCGTGTGAGCACTCGCTGCAGTGAACA
TGTGTTCTCCGTCTTCCTGAACATCAACGAGACCTTCAAG
CTGATGGAGCAGCTGGCCAACATCGCCATGAGGCAGCTGC
TGGACAACAAAGGCTTCGAGCAAGACCGCTCCCTGCCCAA
ACTCAAGAAGAAATCACCCAAGAAAGTGTCTGCCCTCAAG
AGGGACTTGGATGCCAGGGCTAAAAGCGAACGATATCGGG
CTCTTTTCCGCCTCCCGAAGGATGAGAAATTGGACGGACA
CACAGACTGCACGCTCTGGACGCCCTTCAACAAGATGCAC
ATCCTCGGCCAGATGTTTGTGTCCACTAATTACATCTGCT
TCACCAGTAAAGAGGAGACTGTCTGCAGTCTGATCATCCC
ACTGCGAGAGGTGACCATCGTAGAGAAAGCTGATAGCTCC
AACGTCCTTCCGAGCCCCTTGTCAATCAGTACCAAAAACA
AAATGACCTTCTTGTTTGCCAACCTCAAGGACCGGGACTT
CCTGGTGCAGCGGATCTCAGACTTCCTGCAGCAAACCACT
TCCAAGATCTACTTTGAACGGGAAATCACAGGCAGCCTCA
GCAGCTCAGATGACGAGGTGTACTCTCAGCAGGGCAGTGT
GTTGTCCTGCAGTCCTCAGCGCAGTGCTTTGGTCTCTGAG
GGAGAAAGTGAGCGTCAGTTTAATCTGAATGACAACCGTG
TTCCCACTGCCACACAAGCCCTGATGACCATGTACCGCCG
CCGATCGCCAGAGGAGTTCAACCCCAAACTGGCTAAAGAG
TTTCTGAAGGAGCAAGCATGGAAGAATCACTTCACTGAAT
ACGGTCAGGGTGTGTGCATGTACCGAACAGACAAAACCAA
AGACCTGGTGCTGCAGGGCATCCCGGAGAACATGAGAGGA
GAGCTTTGGCTGCTGTTTTCAGGAGCGATTAATGAGATGG
CCACTCACCCGGGGTATTATGAGGATCTGGTGGAGAAGTC
GATGGGCAAATATAATCTGGCCACAGAGGAGATTGAGAGA
GACCTGCACCGCTCACTGCCTGAACATCCTGCTTTCCAGA
ACGAGATGGGCATCGCTGCGCTCAGAAGAGTCCTCACTGC
ATACGCCTTCAGAAACCCCAACATCGGCTACTGCCAGGCG
ATGAACATCGTGACGTCTGTTCTGCTGCTGTACGCTAAAG
AGGAGGAGGCCTTTTGGCTGCTAGTGGCCATGTGTGAGCG
TATGCTTCCCGACTACTACAACACCAGAGTCGTAGGTGCT
CTGGTGGATCAGGGTGTGTTTGAGGAGCTGGCTCACGTGC
ACGTCCCGCAGCTGTATGACTGTATGCAGGCTCTGGGCGT
GATCTCCACCATCTCTCTGTCCTGGTTCCTCACACTCTTC
CTCTCCGTCATGCCCTTCGAGAGCGCCGTAGTGGTGGTCG
ACTGCTTCTTCTACGAGGGCATCAAAGTCATCTTCCAGCT
CGCTTTGTCTGTGCTCGACGCCAACATTCATCAGCTACTC
GGCTGCAAAGACGACGGAGAGGCCATGACCATCCTGGGCA
GGTATCTGGACAGCGTGACCAATAAGGACAGCACTCTTCC
TCCAATCCCTCATCTTCACTCTCTGCTAACGGATAACGGA
GAGCCTCATCCTGAAGTTGACATCTTCAAACTCGTGCGCA
GCTCATATGAGAAGTTTGGCTCCATTCGTGCAGATGTGAT
TGAGCAGATGCGTTTCAAACAGAGACTCAGGGTTATCCAG
GCCATTGAAGACACCACCAAACGCAACGTGGTGAGAACCA
TCGTGACTGAGACGCCGTTCAGCATCGATGAGCTGGAGGA
GCTGTACTCGCTCTTTAAGGCTGAGCATCTGACCAGCTGT
TACTGGGGCAGCAGCAGTAACCCGATGAGCCGTCATGACC
CCAGTCTGCCATATCTGGAGCAGTACCGCATAGACCTGGA
GCAGTTCAAGGGTCTGTTCACTCTGCTCTTCCCCTGGGCC
TGCGGGTCTCACGCTGACGATCTGGCCTTCAGGTTTTTCA
GATTGCTGGACCACAACACTGACGCGCTTATCAACTTCAG
AGAGTTCATCAGCGGCCTGAGTGTTTTGTGTCACGGGGAC
CTGACGGAAAAACTCAAATTTCTCTACAAGATTCACATAC
TTCCAGAGTTGCACCATGAGCAGGAGGAGCCGGACTCAGC
CTGTGAAGCCACACAGTATTTTTTTGAGGACATCACTCCA
GAGACCTCCAGCGGCCTCGACCACAAGAGCAGAAGTGAGA
AGGACGACGGTTTCGTCAGAGTCACGTTTAAGAATGAGAA
AGTTAAGAAAACACACACTGCAGATTACAGGACGTACCTG
CGCCTCTGGAATCAGGAGACCAAAGCCAAGCTGGAGAACA
TGAAGGATCTGCCCAAACTTAACCAGAGTCAGTTCATTGA
GTTGTGCAAAACCCTCTACAACATGTTCAGCGAGGATCCC
AATGAGCAGGAGCTTTATCATGCCACGGCTACAGTCACCA
GCCTGCTGCTGGAGATGGGTGAAGTGGGAAAACTCTTCTG
TACACCCGCTAGCAAACACAACAATGAAGACGATGATGAG
GAAGAAGACGAGCGCAGCATCCCGACATGCAGAAACAAGC
AGGACAGACCACATCGCAAACCCTGCGACATCACGCCTCC
ATTAGACGAGATCAAACTGGAGGACTCGTCACCTAAAGAC
ACGGCTACGTCTTCCGCTATGCTAATCTCGGATGACGAGA
CCAAAGATGACACGTCCATGTCCTCGTACTCCGTCCTGAG
CGCCGGATCGCACGAGCTGGACGATAAGCTTCAGTGCGAG
GATATCGCAGACGACACCGTTCTCATACGCAATGGCGGAG
CAGGGCATCATGGGAGATCCGGGCTTCCTCACAGCGCTAG
CATCGATAAAGACTGGGCCATCACTTTCGAGCAGTTCCTA
GCCTCCGTCCTCACTGAACAGGCCCTCGTGCAGTACTTCG
AGAAGCCGGTGGACGTCGCCGGGCGGATCACCAACGCCAA
GAACGTTCGCAAGGTGGGACACCAACACATGTCCGTTAGC
GACTACGAGATCTCGCTATCCGGCTAACGGGATTACATTT
GAAAACTATTGGTTGAAGGTTGGCGGGAATGCGAGTTCCA
AAAATTCTAATTATGACATCATTTGTTGTTAAATGTGTTC
CAAACCTGTTCATTTTAGTGTTACGATGAAAGTAGAAGGT
GACCCGTTGTGTTAAGCTAATTATAAAAAAGGCAATTAGA
TCTGAAATGAAATGTTCTTCAAAGCAAATAGTGACTAGTT
CATCCAAAAATGAGATTTAACTCATTTTCTCTTCCTCAAG
TGTTTCCAAATCCTTTGTGATTTTCTTTTCATTCAGTTGA
ACACAAAAGAAGATATTTTGAAGAATGCTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations