header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6698
Transcript Name: otpb-202
Previous Name: otpb-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023720 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023720|OTTDARG00000019338|ZDB-GENE-990708-7 otpb|OTTDARP00000019673 otp-002 LG_ BX470070.27 Danio rerio protein_coding KNOWN, 1825 bp
GCGCTTTTTAAAAGGGTTAAAGTTGTAGAGTAGTTTGGGA
AGCAGTTGTGACTCCAGCAGTGCGCAATGCTCTCTCATGC
CGACCTCTTGGATACTCGCCTCGGTGAGTTATCGCCACCA
AACTCCGGTCTTCAACTCCACTGGATGAAGGATGCTGCAG
CCGAGCTTCTCGTACACCGAGAAGCTTTAAAATGCAGACT
AGGGGGGACTGACTCTGGACACCCCGGCGACCTTACTTCT
GCCACAGAGACTGTGGAGGGGACCACTCTGCTCCCCGGAG
AAGAAATAAGTAATGGTGGATCCAATCCTAATGGAATGCA
GCAGGTCAACGCCAAAGACCAAGAAAAGCAGCAACAGCAA
AACTCCAATCAGACGGGCGGCCAGCAAAACCAACAGAAAC
AGAAACGCCACAGGACCCGTTTTACTCCAGCCCAGCTGAA
CGAACTAGAAAGGAGCTTTGCTAAAACCCACTATCCTGAT
ATTTTTATGAGAGAGGAACTTGCATTAAGGATTGGTTTAA
CGGAGTCACGGGTTCAGGTATGGTTTCAGAATAGACGTGC
AAAATGGAAGAAACGAAAGAAGACGACCAATGTTTTCCGG
GCGCCGGGCACTTTGCTGCCAACACACGGTTTGCCTCAGT
TCCCGTCTGCGGCCGCGGCTGCGATGGGCGACAGTCTCTG
CTCTTTTCATGCCAACGACACTCGCTGGGCCGCGGCTGGG
ATGCCGGGGGTCTCACAGCTGCAGATACCGCCGTCGCTGG
GTCGACAGCAGGCGATGGCACAGTCCCTGTCTCAATGCAG
TCTCGGAGCGGGTCCGCCACCAAACAATATGGGCCTTTCG
GGCAGCTTATCGTCAAACGGTTCCGGTCTTCAGTCGCATC
TCTATCAACCCACATTTCCCGGGATGGTGCCCGCTTCCCT
GTCGGGTCCAACGAATGTTACCGGCTCTCCTCAGCTGTGT
AGCTCCCCAGACAGTGACATGTGGAGAGGGACTAGTATCG
CTTCCCTTCGCCGTAAAGCACTTGAGCACACCGTTTCAAT
GAGTTTCACTTAATCTGAGCACCCGCGATGTCTTTTTCTG
TCACTACAAACCTCAAGTATTCCTGAAAAACAGTCATGGA
GCACTCAGGATGCGAGGTTCTAACGATGAAATTACAATTT
GGCAGCCTTACTGGATGATGGAATCCCAACATACCCTCAG
ACAATGCTTACAGCAAATGTAGACTAGTGTTAGTTTTAAT
GCTTGAAATGTATGTAATTTATTTAAGTGTTGGATTCGTT
CATGTTTATTTGTTTATTTTTATAGAAGTTGATTTTAAAA
ATGGGGAATTGTTTATTTATTTTTGAGTATTTATTTGACT
CTTCGTTCATATATGAATCAACAGCTGCAAGTATATTTAT
TTCGCTGTTCAGTGATATTATTTTTTATTAAACCTACTGT
AAAAGGACAATTATAAACGAGGACCACATATGTGCATGTA
CAGGTTGTTTCAAGGCACAAACTACATGTTGGAGCGATTT
TTCAGGTACAGAAATGAACACGTTGGATTAAGAGCCAATT
TCCAAATAACCAGATTCGGATGCATGTAATATTTCAAACG
GGATCAACAGGAAGTTGTTTACAAAAGCAAAATGAACTTG
AGTGTTTGTGTAGATAAGACAAAAAATAATGTTATCTGCT
GGTACGTTTGTGATATGTTTTAACTTATTGTCTGTGCTTA
TTACTGAAATATGGTTTTCGTAAATGTTTATCTTACCAAA
TTCAACAGAATTGGGAAGGTTTATATCAATGATTGTTAAG
TGGGTGAATAAAATCATTTTAAGAA

otpb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA otpb-201 (1)    Ensembl 1845
otpb-202 1825
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
otpb-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000023720 (1),  Ensembl_Trans:ENSDART00000134606 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AF071496 (1) 1880 bp
GenBank:DN896912 (1) 657 bp
GenBank:AL925229 (1) 573 bp
CITATIONS (2)