Transcript

gngt1-202

ID
ZDB-TSCRIPT-090929-6533
Name
gngt1-202
Previous Names
  • gngt1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023455 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023455|OTTDARG00000019165|ZDB-GENE-030131-7596 gngt1|OTTDARP00000019490 gngt1-002 LG_ BX537314.17 Danio rerio protein_coding KNOWN, 493 bp
CACAACATGTAAATGATATGATTGTTTGATTTCATGCAGA
AAATGCCGATCATAGATGTAGAAAATATGACTGACCTGGA
TAAGGCGAAGATGGAAGTAACCCAGCTCAAAACTGAGGTG
AAGCTAGAAAGGGCGAAGGTGTCCAAATGCTGTGAAGAGA
TTACAGAGTACATTCAAGGAGGAGCGGATGAAGATCCTCT
GGTCAAAGGCATTCCAGAGGAGAAGAACCCGTTCAAGGAG
AAAGGTGGATGTGTCATTTGCTAAAGTGGACAGAAAATCC
CCCAACATTCGCAGTTTAGTGTTCACTGCTGCCCATGGAC
ACCTGTTAAAAACGTAATACTTGCTGGAATTCGCTGCCCA
AAAAAGGACATTCTCAAACACGGATAGACGTTGGTTAACT
CTAAATGGCTTTTTTCCCTTCATTGTTAATGAATATTCAG
AATTTGGACCTACATATGCTGTGTATTCCCCTTTGAAGTG
TTGTAATAAATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations