Community Action Needed: Please respond to the NIH RFI
Transcript

notch1b-202

ID
ZDB-TSCRIPT-090929-6404
Name
notch1b-202
Previous Names
  • notch1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023258 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023258|OTTDARG00000019016|ZDB-GENE-990415-183 notch1b|OTTDARP00000019364 notch1b-001 LG_none CR396583.6,BX119981.7 Danio rerio protein_coding KNOWN, 7824 bp
CTCAGTTTGAGACCGCACGAGCAACACCGTATTGCGGGCT
CCTGGATCTATCCTTCATACTGACGTGCTTCGTTTCTTTT
TCTTGAACAGACCAATGTTGGATATATGTTAAGCCTGCGT
GGACTATCCATAAGAAGGAATGCATCTTTTCTTCGTGAAA
CTAATTGTTGTGATATCACTCAATACTTTGACACAAGGCC
TGGAATGTTCAGAAAAATGCCAAAACGGAGGCACATGTGA
ACCAACTGCAGACGGGAGAGGAGAATGCAATACGCCGGCC
CAGCGTGCCAGTTCCGCAACCCTTGCTTCCAATCCCCGTG
CAGAAATGGTGGCGTGTGCCGTTTGATCACTTCTGCCAAC
AAGGTGGACTTTGTCTGCAACTGCAGCCTGGGCTACACGG
ACCGATTGTGCCTCACTCCCACCAACAACGTGTGCCTTGG
TGCTCCGTGCCGAAACGGAGGAACGTGCGAACTCACCAGC
ATCCACAACTACAGGTGTAAATGCCCACCAGGCTGGTCAG
GTAAAACCTGCCAGCAAGCTGATCCCTGTGCCTCGAATCC
TTGTGCCAATGGTGGTCAGTGTAGCCCCTTTGATTCGGAC
TTCCTCTGCCACTGTACACCTTACTTCTCAGGCCAAACCT
GCAAACAAGATGTCAACGAGTGCGCGCAGATTCCCTCTCC
GTGTAAGAACGGTGGCGTGTGTGAGAACGGAGTGGGCACG
TATCACTGCAACTGTCCCGCCGAGTACACTGGGAAACACT
GCGAGAGCCTGTATCAGCCGTGTAACCCCTCGCCATGCTT
ACACGGGGGCACCTGCGTACAGAAGGGGGAGACCAGTTAT
GAGTGCTCCTGTCTGCCAGGTTTTAGTGGGCAGAACTGCG
AAGAAAACATCGATGATTGTCCAGATCATCGCTGCCTTAA
TGGAGGGACCTGTGTGGATGGAGTGAACACCTACAATTGC
CAGTGCAAACCAGAGTGGACAGGTCAGTTCTGTACCGAAG
ATGTCAACGAGTGCGATTTGATGCCCAACTCCTGCCAGAA
CGGTGGCACGTGCTTGAACACGCAGGGTGGGTATAACTGT
GTGTGCGTGAACGGCTGGACGGGGGACGACTGCAGCGAGA
ACATCGACGACTGCGCAGATGCAGCCTGTCATACTGGAGC
CACATGCCACGATCGGGTGGCCTCCTTCCTCTGCGAATGT
CCTCACGGGCGCACAGGTCTGTTGTGTCATCTAGATGATG
CTTGCATTAGTAACCCGTGTCAAAAAGGCTCTAACTGTGA
CACCAACCCAGTCAACGGCAAAGCCATCTGTACCTGTCCA
CTGGGTTATGTTGGGCCGGCCTGTGACCAAGACGTTGATG
AATGCTCACTGGGTGCAAACCCTTGTGAACATGCTGGAAA
GTGTATAAACACAAAAGGCTCGTTCCAGTGTAAATGTCTG
CAGGGATATGTTGGAGCTCGATGTGAGCTGGACATAAATG
AGTGCCTTTCCACCCCGTGCCAAAACGACGCCACCTGTTT
AGATCAGATTGGAGGATTCCATTGCATCTGTATGCCAGGG
TACGAGGGAGTCTTCTGTCAGATCAATACCGATGAGTGCG
CCAGCATGCCCTGCCTCAACAATGGGAAGTGCATCGACAA
GATCAACAACTACCAATGCGAGTGCCCCACAGGATTTTCG
GGGAGCCAATGCCAGTTCGACATTGACGAGTGCGCTAGTA
CTCCTTGTAAAAATGGGGCCAAGTGTATGGATGGGCCCAA
TATGTACACCTGCCAGTGCACTGAAGGATACACAGGGCAG
CACTGTGAGACAGATGTAGATGAGTGTCTGTCCAACCCGT
GTCACTACGGCACCTGTAAAGATGGCCTGGCGTCCTTCAC
CTGCGTCTGCCGTGCGGGTTTCATGGGCCGTCTGTGCGAG
ATCAACATTAATGAGTGTCTCAGTCAGCCATGCCAAAACG
GAGGCACCTGCCAGGACCGTGAGAATGCCTACTTGTGTGT
CTGCCCCAAAGGAACTGCAGGAGCTAACTGTGAGATCAAC
CTGGATGACTGTCAGAGCAATCCCTGTGATTTCGGGAGAT
GCATCGACAAGATAAATGGGTACGAGTGTGCCTGCGAACC
GGGATACACAGGGAAAATGTGCAACATCAATATCGATGAA
TGTGCCATCAACCCCTGCCACAATGGCGGAACCTGTGTGG
ATGGAGTCAATGGCTTCACTTGTCTGTGCAGAGAGGGCTA
TCATGACACCACCTGCCAATCACAGCTCAACGAATGCCTC
AGCAACCCCTGTATCCATGGACACTGTGAAGACAAAGTCA
ATGGATATAACTGTATTTGCGACTCTGGCTGGAGTGGAGT
CAACTGTGACATTAACAACAACGAGTGCGAGTCCAACCCC
TGTATGAATGGAGGCACTTGTAAGGACATGACCAGTGGCT
ACGTCTGCACATGTCGCGCCGGCTTCAGCGGTCCCAATTG
CCAAACGAATATCAACGAATGTGCCTCCAACCCATGCTTG
AATCAAGGAACCTGCATTGATGATGTGGCCGGATACAAAT
GCAACTGTCTGCTTCCTTACACTGGCGAGAACTGTGAGAC
CCTGTTGGCCCCGTGCGGCTCTAAACCCTGTAAGAACGGA
GGCGTTTGCAAGGAATCGGAAGACTACGAGAGCTTCTCTT
GTGTGTGTCCTGCGGGATGGCAAGGCCAAACATGTGAGGT
GGACATCAACGAGTGTGTTAAAAATCCTTGCCGAAATGAC
GCCATCTGCCAAAACTCCATTGGCAGCTACAAGTGCAGTT
GCAAAGCGGGCTACACGGGTCGCAACTGTGAGACAGACAT
CGATGACTGCAAGCCCAACCCCTGCAGTAACGGTGGCTTC
TGCAAAGACGCAGTGAACGCCTTCGCTTGCACCTGCCTGC
CGGGTTTCAGGGGCGGCAGATGCGAGGAGGACATTAACGA
ATGTGAGAGTAACCCGTGTAAAAACGGCGCCAACTGCACT
GATTGTGTGAACAGCTACACCTGCACCTGTCCACCTGGAT
TCAGTGGGATTCACTGCGAGAACAACACACCTGACTGTAC
TGAGAGCTCTTGTTTTAATGGTGGCACATGTGTGGATGGC
ATCAACAGCTTCACTTGCCTGTGCCCTAAAGGCTTCACTG
GCAACTACTGCCAGCATGACATCAACGAGTGCGACTCCAG
ACCGTGCATGAATGGAGGCACCTGCCAGGACAGCTATGGC
ACCTACAAGTGCACCTGCCCTCAGGGATACCACGGTCTTA
ACTGTCAGGAGCTGGTGAACTGGTGTAAACCGTCTCCCTG
TAAGAATGGAGGGATCTGCAGACAGAGCGGCACGAGATAC
AGCTGTCAGTGTCAGACAGGCTGGACTGGTTTATACTGTG
ACGTTCCCAGTGTTTCCTGCGAGGTGGCCGCCAAACAGCA
AGGTGTTGATGTGGTCCGGCTGTGTCGTAACTCTGGCCAG
TGTCTGGACGCTGGAAACACACACTATTGTCACTGTCAGG
CCGGATACACGGGCAGCTACTGTGAGGAGCAGGTGGACGA
ATGCATTCCCAATCCGTGCCAGAACGGAGCAACTTGCACC
GACTACCTGGGCGGATACTCCTGTGAATGTGTGCCAGGTT
ATCATGGAGTGAACTGCTCTGATGAGATCAATGAGTGTCT
GTCTCAGCCCTGCCAGAACGGGGGCACATGCATCGACCTG
ATCAATACCTACAAATGCTCCTGTCCTCGGGGAACACAAG
GTGTGCACTGCGAGATCAACATTGACGACTGCACACCGTT
CACTGACCCCATCACCCATGAGCCTAAATGCTTTAACCAG
GGCCGCTGTGTGGACCGTGTGGGCGGCTACCACTGCATCT
GTCCCCCTGGGTATGTTGGGGAACGCTGTGAGGGCGACGT
CAACGAGTGCCTGTCCAACCCCTGTGGCACACACAGCTGC
ATCCAGCTCAAAAACAACTACCGCTGCGAGTGTCGCACAG
GATACACAGGTCAGCATTGTGACAAAGTGTTTGATGGCTG
TAAAGGGAAGCCGTGTCGTAATGGAGGCACCTGCGCTGTA
GCCAGTAACACTCCTCATGGCTTTATCTGCAAATGTCCAC
CGGGTTTTACGGGCTCGACCTGCGAGTACGACGCTCACGC
ATGTGGGAGCCTTCAATGCAAAAATGGCGGGACGTGCGTT
TCTGGTCACAAGAGTCCCAAATGCCTGTGCACCCCTGCTT
TCACTGGTCCCGAGTGCCAGGATCCCAGCGGAGGCCACTG
CACCACTAACCCCTGCTATAACGGAGGCACGTGCGAGTAT
ATAACCGAGGAGCCGTATTACCACTGCATCTGTCCCACCA
ACTTCAACGGCCTCTTCTGCCACATCCTGGACTGGAGTTT
TCCAGGCGGCACTGGTCAGGACATCACGCCGGCTCCTAAG
GTGTCGGTCAGCTGCGAGATTGAGCAGTGTAAAGTCAAGA
AGGGCAATAAGATCTGTGACAGCGCATGTAATAATTACGC
CTGCGATTGGGACGGTGGCGACTGTTCGCTGAACTTTAAT
GACCCATGGAAGAACTGTTCGGCGGCTCTGCAGTGCTGGC
GCTATTTTAATAACGGGAAGTGTGATGAACAGTGCCACAA
CACGGGATGCCTCTATGATGGGTTCGACTGCCAGAGAGTG
GAGGCACAGTGCAATCCACTATACGATCAGTATTGCAAGG
ACCACTTTGCAGACGGCTACTGTGACCAGGGCTGCAATAA
TGCAGAGTGTGAATGGGACGGCCTGGACTGCGCTAACGAC
ACCCCCGAGAAGCTGGCTGCAGGACTGCTGGTTGTGGTGG
TCCACATTCACCCTGATCAGCTCCGAAACAACTCGTTCGG
GTTTCTGCGGGAGCTCAGCCGAGTGCTCCACACCAACGTG
GTTTTCCGGCGGGATAGCAAGGGGCAAGAAATGATCTACC
CGTATTACGGCAATGAGCAGGAACTGAAGAAACACAACAT
CAAACGATCACTAGACGGCTGGAACGATGCTTCTAGCGAT
GTCTTGAGCTCGATGAAAAACAGCATTTACAATATAGTAG
TGGAAGGAGGGAGAAAACGCAGAGAACTGGAGAAGATACA
AGTCAAAGGCTCCGTGGTTTATCTGGAGATTGACAACCGG
CAGTGCTACCAGCAAACCTCCGAATGCTTCCAGAGCGCCA
ACGACGCGGCGGCGTTCCTCGGAGCGCTGGCTTCCAGCGG
CAGTCTGAAAATGCCTTACGTCATCGAGGCCGTCACAAGT
GAGATCGATGGACCGTCGCCTGTAGAGCTCTATCCAGTCT
ACGTGGTTCTGGCAGGATTGGCGCTGCTGGCCTTTGTCGC
CATTGGGATGGTGGCGTCCCGTAAACGGCGCCGGGAACAC
GGACAACTTTGGTTTCCGGAGGGTTTTAAGACCAGCGAGC
CCAGCAAGAAGAAGAGGAGAGAGCCGGTCGGAGAAGATTC
AGTCGGTTTGAGGCCACTTAAGAACTGTTCAGACATTTCG
TTAATGGACGACAACCAGAATGAATGGGGAGAGGAGGAAC
AGTCCGACAGCAAACGCTTCAGGTCTGAGGAGCAGGCGAT
GCTGGATTTAGACGATCAGCCAGATCACAGACAGTGGACG
CAGCAGCATTTGGACGCAGCCGATCTGCGCATCCCATCCA
TCGCTCCCACACCGCCTCAGGGCGAGATAGAGAACGACTG
CATGGACGTCAATGCCCGAGGACCAGATGGCTTTACTCCT
CTGATGATTGCGTCCTGCAGTGGAGGAGGGCTCGAAACGG
GAAATAGCGAGGAAGAGGAAGACGCTTCAGCAAACGTCAT
CAATGATTTCATCTATCAGGGCGCCAACCTTCACAACCAG
ACAGACCGCACGGGTGAGACGGCTCTACACCTGGCTGCCC
GCTACGCCCGCTCAGACGCCGCGAAACGACTGCTGGAGGC
CAGTGCTGATGCTAACATCCAGGACAATATGGGCAGGACT
CCATTACATGCCGCTGTGGCTGCTGATGCCCAAGGCGTCT
TCCAGATTTTGATACGGAACCGCGCCACAGATCTAGACGC
CCGCATGCATGATGGCACCACACCTCTGATACTGGCCGCA
AGACTGGCGGTCGAGGGCATGGTGGAGGAACTCATCAACT
GCCATGCTGACGTTAATGCCATTGATGACTTTGGTAAATC
TGCTCTTCACTGGGCAGCAGCTGTGAACAATGTAGATGCA
GCGATGGTGTTGCTTAAGAATGGGGCAAATAAAGACATGC
AGAACAATAAGGAGGAGACTCCTCTTTTCCTGGCGGCAAG
GGAAGGAAGTTACGAGACGGCTAAAGTTCTTCTGGAGCAT
TTTGCAAACCGGGAAATCACAGACCACATGGATCGACTCC
CGCGAGACATCGCGCAAGACAGAATGCATCATGATATTGT
GCGTCTTATTGATGAATACAACCTAGTGCGCAGTCCTCCC
ATGCACAGCGCCCCGCTCTGCACCACGCTTTCCCCACCCC
TCTGCTCCCCCAATGGCTTCATGGGCAACATGAAGCCCTC
GGTGCAAAGCAAAAAACCTCGTAAGCCCAGCACTAAAGGC
ATCGGCTGCAAAGACGGCAAAGATATGAAAGTCAAAAAGA
AGAAAGCACAAGACGGAAAGGGAAACTTATTAGACAGCTC
GGCTGTTCTCTCTCCGGTGGATTCCCTAGAGTCGCCTCAC
GGGTATATTTCTGACATCGCCTCGCCACCCCAGATGACAT
CACCCTTCCAACAATCGCCCTCCATGTCGCTCAATCAGCT
ACAGGGAATGTCAGACAACCACATGGGCGTCAGCCATCTT
GGAATTGGCAACAACCAAGATCTTTCCCATATACAGTTTG
ATCCATTGCCTCCACGTCTCACTCATCTTCCAGTGGCCGG
ATCGAACGGTTCAAACGTCATGAACGGCCAATGCGAATGG
CTAGGGCGGATGCATGGAAGCATGGCTCCGCAAAACCAGT
TCACAGCCATGAGAAACGCCTCAGGTCAAGCCAACCTTCA
CCAATCAGGCTTGATGACGTCACATCACAATGGCCGCCCT
GCCACGCTCTCTCAAATGATGAACTATCAAAGCATGCAGA
ACACACATCTAATGCAGCAGATGCAGCAGAGCATGCAGCC
GCGGCCCCAGCAGACCGGCGTCCAGCTGCAGAGCCAGAGC
CAGAACTTCATCGGGGGTGATCTGGGTGGACCGGAGCTCC
AGCAGAGCGCAGGGAACAGCATGTCCATCCATACTATAAT
CCCCCAGGAGACCCAGCTGCTCAACCCGTCCTCTCTGGGG
TCCAGCATGGCGGGCACGCAGTTCCTGACGCCACCTTCCC
AGCACAGTTACACTCCCGCATTGGACGCCAACACTCCCAA
CCACCAACTTCAAGTGCCTGACCACCATCCTTTCCTCACG
CCATCTCCCGGTTCTCCAGACCAGTGGTCCAGCTCGTCAC
CCAATTCCAACATGTCCGATTGGTCGGAGGGTATTTCCAG
TCCTCCCACCAGCATGCAGTCACAAATCGGACACATGCCC
GAGCAATTCAAGTAGAACAATGAGATTCGCTAAATGAAGG
CACATTCCATAAGCCTGCTTATACTGAAGGGTCTTTTATA
CGCCGCTTGTACTAACCTTTTTTTTTCTTTAATTTATTGA
CATTTTGTTATTTATATACTTGTCATCATTTTTTTTTTAA
TTTGGGCACAAAACATTAAATCTTAAAGTCGGCATGAAAT
GAAACTTAAAATTGTTGATTTTTCACCTAACATTACATCC
GATTGAAACGATTTGTGAAATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations