ZFIN ID: ZDB-TSCRIPT-090929-6343
Transcript Name: rx3-201
Previous Name: rx3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023151 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023151|OTTDARG00000018942|ZDB-GENE-990415-238 rx3|OTTDARP00000019271 rx3-001 LG_ BX248399.5 Danio rerio protein_coding KNOWN, 1411 bp
GTGCAGGGCCACTGTTGGAGAAAGTCGCTTTTCTGCCGGG
ACAGTCTGGACTATTGGACAGAAGTTTTCACCAAGAAATT
TTAAAACTGAGTATATATTTTTCCTCAAATCGTTCAATGA
GGCTTGTTGGATCTCAGTATAAAGACATGGAAGATCGTCT
CTCTCCATCCGCGCGCTTGGTCCGCAGTCCCGGGTCCCAA
ACGAGGATCCACAGCATTGAGTCAATTCTGGGATTTAAGG
GAGAGACTCTGTTTCACCCGGCGTTTCCATATGGATCGGG
AAAGACAGGCAAAGACACCGAGCACTTGTCCCCGAAAAAG
GACTCGAATAAACACTTTGATGGAGTTTGTAGGTCGACTG
TAATGGTCAGCCCAGATCTGCCAGACGCGGATGGTGGTAA
ATTGTCGGATGATGAAAACCCGAAGAAAAAGCACCGGCGG
AACCGAACCACGTTCACCACCTTCCAGCTCCACGAGCTCG
AGCGCGCCTTCGAGAAGTCGCACTATCCGGATGTCTACAG
CAGAGAGGAGCTCGCGCTGAAGGTCAACCTGCCCGAAGTC
CGAGTACAGGTGTGGTTCCAAAACCGTCGAGCTAAATGGC
GGCGTCAGGAGAAGCTGGAGGTGAGCTCCATCAAGCTGCA
GGAGTCCTCCATGCTCTCCATCCCCAGATCGGGGCCACTG
TCCCTGGGCAGCGGCCTGCCGTTAGAGCCCTGGTTGACCG
GCCCCATCTCCACCTCCAGCTCTCCTCTGCAATCTCTGCC
CAGCTTCATCACCCCTCAGCAGGCCGTCCCAGCCAGCTAC
ACCCCTCCACAGTTCCTCAGCTCCTCCACCCTCAACCACA
GTCTCCCTCATATAGGGGCTGTGTGTCCCCCGTATCAGTG
CTCTGGCTTTATGGATAAATTTTCACTTGAAGAAGCAGAT
CCACGAAACACAAGCATCGCCTCGCTGAGGATGAAAGCCA
AGGAACACATTCAGTCTATAGGGAAGACGTGGTAGATGAG
AGACATTCAGAGACTTATTTTAGTTTGTATCTTCAAAATC
AGTGGTCTGGATCCGTTTTTCTTTTCTAAACTTCAGTTGT
GGATGACAATCTTTGTAAAAACAGATAAACATTGTACATG
ACTTTGATTTTTGGGTCATTGTAGGGCAGGTGGATCTCTT
TCAGCCCTCTTTTTAACCTTTAAAGCAGTTGAAGAGGGAG
TTAGGAATGGAAATGCATTATAAATGCAGGCTTTTAGTTT
CATTGAATCGCATTTGGCATTCAAAAGGCCCGTTCTGTGC
TAGGATTTATTCTCTGTTGAGTACTGTACAATGCAGCTGG
CCACTTTCCATGATGTTTTGTTGTATGTTTTCACACTTGT
ACAGATGAATTTTGTATTTTATAATAAAAACAAAGTCATA
AAAATAACAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rx3-201 Contained in:
[BAC] CH211-233A1 (1)

Genome Resources: Vega_Trans:OTTDART00000023151 (1),  Ensembl_Trans:ENSDART00000074833 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AF001909 (1) 1322 nt
GenBank:AL918329 (1) 539 nt
GenBank:BI888414 (1) 511 nt
CITATIONS (2)