Community Action Needed: Please respond to the NIH RFI
Transcript

myt1la-201

ID
ZDB-TSCRIPT-090929-632
Name
myt1la-201
Previous Names
  • myt1la-001
  • si:dkey-260n20.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006101 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006101|OTTDARG00000005629|ZDB-GENE-041001-172 myt1la|OTTDARP00000005446 myt1la-001 LG_ BX248326.14 Danio rerio protein_coding KNOWN, 4144 bp
GCTCTTCCACTCTCTCTCCCTCCATCTCTCTCCAAGTGCT
GGCGGAATACCGAGCTCAGACAAAGAAAGCTCAGGAGAAC
AGAGGAGAGAAGTGAAAAGAGGAACAGAAAAAAAAGCGAT
TTAAAGAGAAAAAGAGAAAGACGGGTGCAGATCTGCGGTG
TGTGAGGAGACAGAGAGAGGGAGAGAGAAAGACAGTGTCG
CCATTTCAAAAATGAGTTTTGAGGAACAGCTTTGAGGGAC
ACACAGTGGACAATTCTGCCTAATCGCACCACACAGGAGG
CGCTTCCAGAAAACACACCTGTCCCACCATCAACCACTGC
ATTCAGATGGAGGTGGATGCGGCAGAGAAGCGTCATCGAA
CACGATCTAAAGTTGCCGTAGAGGCTGCACAGGAGCTATT
CAGCTGTCCCACACCTGGCTGTGATGGTAGTGGACATGTC
AGCGGCAAATACGCCAGACACAGGAGTGTGTATGGATGCC
CTTTGGCTAAGAAAAGGAAAACCCAAGAGAAACCTCTGCA
GGAACCTGCATCCAAACGCCGTCCGTTTCTAACTATGGCT
GACGGAGAACACGCTATGTATGAAAACTATGAAGCAGAGG
CCATGGAGGAGGGAGAAGAGCGGGAACAGGAAGAGATAGA
GGAAGTGGAGGAAGATGAAGAGGAAGGAGAAGATGAGGAA
GAAGAGTGCTCGGATGACAACGAGGATCTGGGAGAGGAGG
AAGAGGAAGAAGAAGGAGAGGACGATGGAGAGGTGGAAAG
AGAGGATGTAGAGGAGATTGAGCAAATGGAGGAAGAGGTT
GAAGAGGACGAGGAAGTGGTGGAGGAGGATGGGGATGATG
AAGAGCAGGAGGAGGATGATGATGAGGAGGAGGATGATGA
TGAGCACGATGAAGAGGAATACTATGGAAATCTGAGTCAT
CAGCAAGACGACAATTATTCTAGTGGACAATCAAAATCCA
ATCATATGATTGAGAAAGACAATAACAACAACAACAACAA
CACGAACAATGAGGAGTATGAGAATTATGACGAGCTGGTG
GCCAAGTCTCTCCTCAACCTGGGTAAAATTGCAGAGGACG
CTGCCTACCAGGCCATGACCGAGTCGGAAATGAACAGCAG
CTCCTCCAACAGCGCCGGAGAAGATGATGACGAAGATGAA
GATGACGGAAGCGAACAAGGATGCCACAAAGGAGAGTTGA
GTGTCGACTTGGATAGTGATGTGGTTCGAGAAACGGTGGA
CTCCCTGAAGCTTCTGGCCCAGGGTCATGGAGCTGTGCTG
CCCGATGAAGGATACGCGGACGCCGGGTCTGGAGATGCTT
GCCAAGCTAATGGACGTGGCCAGGCAGAGGAGAGCGAGGA
GGAAGTGTGCCTAAGTAGCTTGGAGTGTCTGCGTAATCAG
TGTTTCGATTTGGCTCGAAAACTCAGTGAGACCCAACCAT
CAGAACGGCCCTTGATGGAGCACCACATGCAACATCATTC
CGAGCAGCAGCAGCCACAACATTTGCATCCGCATCCTCAT
CCGCATCACCCTCCAATGCCCCGCTACGACAGCTGCCAGA
TGGACCAACACAGACCCCTCGAGCGGAACTACTCAGACAT
GGTGAATTTGATGAAACTAGAGGAGCAGCTCAGTCCCGCT
TCCAGAGGCTACCCGTCTAGCTGCGCCCAGGACGGGGATG
AGGACACTACCTCGGTGGCCTCCGATCGCTCAGATGAAGC
TTTCGACATGACTAAAGGCAACCTGTCGCTGCTGGAAAAG
GCCATTGCTCTGGAATCGGAGCGTGCCAAGGTTATGCGAG
ACAGAATGGCATCAGAACAGATGGTGGCTCGGAGGGACAA
TCAGCGCCTTCATGGAGAGCACAGCCCAAGGCAGAGCAGC
AGTGCAGAAGAACGCAAGGCCCGACTCCATCATGATGGCG
CAAAAAGAGCTTACTACCCTAAAGACTCAAGGGGAGAAAA
AAAGGAAAGCAAGTGTCCAACCCCGGGTTGTGATGGCACA
GGCCACGTAACTGGACTTTATCCTCATCATCGAAGCTTGT
CCGGCTGCCCACACAAGGACCGCGTGCCACCAGAAATTCT
TGCAATGTATGAGAATGTTCTAAAGTGCCCCACGCCTGGC
TGCTCGGGACGCGGCCATGTAAATAGCAACAGGAACTCGC
ACCGCAGTCTCTCGGGATGTCCCATAGCTGCCGCTGAGAA
GATGGCAAAGGTTCAGGAGAAACATCACTCCTGCGACGGC
CCCAAGTCCAACCAGGCGTCAGACCGTGTCTTGAGGCCCA
TGTGCTTCGTGAAACAGCTGGAGATTCCAGAGTATGGGTA
CAAAAACAATGTTCCAACCAGCACTCCGCGATCCAACCTG
GCCAAAGAGCTGGAGAAATATTCCAAGGCCAGCTTTGACT
ACAGCAACACTTACGAAAACCAGCCTCATGCTTACGGCAA
GAGGTCCCTCATCCCGAAGAGCCACGGCCGAGACACTTCA
CCCAAAGGATATGATGCGAAGCGCTACTGTAAGACCTCGA
GTCCGGCCAGCAGCACCACGAGCAGCTACGCTCCCAGCAG
CAGCAGCAGCCTGAGCTGTGGAGGAGGAGGAGGGGGAGGA
GGAGGAGGGGGAGGAGGAAGCAGCGCCAGCAGCACCTGCA
GCAAGAGCAGCTTCGACTACACGCACGACATGGAAGCCGC
CCACATGGCCGCCACTGCCATCCTCAACCTGTCCACGCGC
TGCAGAGAGATGCCCCAGAGCCTCGCCGCAAAGGGCCCCG
AGCTCCTGGCACAGAGTCCTGATGACAGAGACGGAGATGA
TAGCAGAGCTCTGGATGTGGGCCGGGTCGGAGGGATGGGG
GAGGGCAGTGGGGGCACAGTCCTGACCCCCCTGCAGCCCA
TGTCGCCCCAGCGGCAGGCCCTACTCAACAGCCACTGCTA
CCAGATGAGCACGGCGGACTGCTGGGACCTGCCTGTGGAC
TACACCAAGATCAAACGACTGGATGATGACCACAAGGAGG
ATGATCTGGACCCCTTTCAGGATCTATTAGAGGATCAGCA
GTATTCAGGAGAAGTGTCTCTTCCCAGCCCCAAACACAAA
TATGCTCCCTGCAAGGAGAGCAAGAAGGAGCTCCTCACGC
TATCAAGCTGCCAACTGGCTGACAAGGGCATGCGTGGCAT
GATGACATCCAACTCCCAAGATCTGAAGTGTCCCACTCCC
GGCTGTGATGGCTCTGGGCACATCACTGGCAACTACGCCT
CGCACAGAAGTCTGTCAGGTTGTCCCCGGGCAAAGAAGAG
TGGCATTAAAATAATGCACAGTAAGGAGGACAAGGATGAC
CAGGAGCCAATCAGGTGTCCAGTGCCAGGCTGTGATGGCC
AGGGTCACGTGACAGGGAAGTATGCCTCCCACCGCAGTGC
ATCCGGCTGCCCGCTGGCCGCCAAGCGTCAGAAAGACGGT
TATGTGAACGGAGCACCTTTCTCCTGGAAGTCGGGAAAGA
CAGACGGCATGACCTGCCCCACTCCAGGGTGCGACGGATC
AGGCCACGTCAGCGGAAGTTTCCTCACCCACCGGAGTCTA
TCTGGCTGTCCCCGTGCCACGTCTGCTATGAAGAAAGCCA
GAATGACTGGGGTTGAAATGCTCACAATCAAGCAGAGAGC
AAGTAAAGGCATCGAAAATGATGAGGAGATTAAACAACTG
GATGAAGAAATCAAAGACCTGAATGAGTCGAACAATCAAG
TAGAGTCAGACATGATCAAATTAAGGACTCAAATCACAAC
CATGGAGACTAACCTGAAATCCATCGAAGAGGAAAACAAG
GTCATCGAGCAGCAGAATGACTCACTTCTGCACGAGCTTG
CCAACCTCAGCCAGTCCCTCATCAACAGCCTCGCCAACAT
CCAGCTCCCTCACATGAAACCGATGCCACTGAAAGAGGCC
CCTGTTAAAAATTACTGCTGTTTACAGATGCCCCACAGAG
AGCCGATGAACGAGCAAAACTTTGACACTTATGTGAGCAC
TTTGACAGATATGTACACTCACCAGGACCAGTATCAGAGC
CCGGAGAACAAGGCCCTCCTGGAGAACATAAAGCAAGCTG
TTCAAGGCATCCAAGTGTAGCTTTGCAGTTGGGGTAATGG
GGGTCATGTGATAAGAATCGATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations