ZFIN ID: ZDB-TSCRIPT-090929-625
Transcript Name: hebp2-201
Previous Names: hebp2-001, zgc:56136-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006087 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006087|OTTDARG00000005617|ZDB-GENE-040426-914 hebp2|OTTDARP00000005434 hebp2-001 LG_ AL929182.4 Danio rerio protein_coding KNOWN, 1682 bp
GCCTTCGCATGGGAGTGATGTAACATGAAAACACGGAAGT
AGTCCTGTCAGCGTTACTTAAGCGTAGAGTTATTTAACAG
CGAAACTGTATATTCTCTATCTAAGCGTTATAACACACCC
GTGCGCGTGTGTGTGTTGGGCGAATAAATTCAGCTCTCCA
TCTTTTCTGGTTGTTCAGTCGCTTTCTGCTTTTAATCTGT
CAACAGCGGACAGTTTTAAGTCGAGATGCTTAAAGCCATC
GGTCAAACTCTGTTTTCTACTGGACTCCAAAACCCCAAAT
ACACAGCTCAGGAGAGTAAGGGTGATGACTATGAAGTCCG
CACCTATCAAGCAACAAACTGGGTAAGCACAGTTGTGACT
GGCATGGAGCAGGACCAAGCCATGAGCACAGGCTTTAGAA
GACTCTTCAAATACATTCAGGGCAGTAATGAAAAGAAGAG
TAAGGTGGAGATGACGACACCGGTGAGTTGTTTGATTGAC
CCTGGAGCGGGACCTGCATGTGAAAGCACCTTCACTGTGT
CCTTTTACATCCCTGAGGAACATCAAGCTGACCCTCCCAA
ACCCACTGACCCAGATGTTTTTATCGAGAGCAGAAAAGAG
CTCACTGCGTTCGTCAGGACCTTTGGTGGCTTTGCTAACA
GTGAGAGCTGCCGTGAGGAGATTCTCAAACTCATAGAAAG
CCTCAAGAGGGATGGCATGAAATTTAAAGAGGCACCATAT
TACCGAGCAGGATACGACAGTCCCTTCAAACTCACCGGCC
GTAGGAATGAAGTCTGGCTCATCAAAGATGAGGAGTAAAT
CTCCTATTGATCAAATGGTCATCTCGCCTTATGATGTGAA
TGAAGGTCAATTTGTCTGTCTGAACTTGAATTTCCTCATC
ATTTACTCACACTCAAGTGGCTCTAACCATTGATGAATGT
CTTTCTTCAGTTGGACACAAAACAAGCTATTCTGAAAAAC
CAACAGACATCCAGAGTAGGAACAAAAATATACTATGGAT
GTCAATGGGTGCTACCTTCCAACATTTTTCAAAATATCTC
CTTTTGTGTTCAACAGAAGACAGAAAGTCAGGTTTGGAAC
AAATGTGGAATGAATAAATGATGACAGAATTGAACTGTCC
TTCTAACAATAGTTAATATCATGTTGATGCATGTTTATTT
TGTGCCGTAGGTGCCTGGATGTTTTTATATGACAATTAAC
ACTGTGTTGATTACATAAGTGACCAATATATATTTACATC
AGCATTACCACTTTATTGGGGCTAAAATTAACCATGAACT
CATGCCAAAAGCATGTTGAAATGATTTCTAATAGACCATC
AGACTGAATTATTGCTTTAATCCAGCTGTTTGCAGTGGAA
AAAAATGTTGGTCGTCTGACCTTTTTGTTACTAATAATGT
ATGGATGCACAGATAATGCTTGTTTAAAGTACTTCATGTT
CATGACATGACTGAATTACTGACACTTTTCATGCTTTGAA
ATGTAAATGCATAATTTTACCTGGTCATACAATGCACTAA
GTGTTGAAATTAAAAATATAAGGGAACAATAGAAGACTAG
TTTGACTAAATGTTTTGTACATTGTCGTTTTGTTACTGAA
ATAGCGTACTGACACGCTTTTTTAGGCTTGTAACTTCTGG
CCCTCTAGCGGTTAAAAATAAAAGTGCACGTGTCTTGCAG
AA

hebp2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hebp2-201 1682
hebp2-202 (1)    Ensembl 777
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hebp2-201 Contained in:
[BAC] CH211-195E3 (1)

Genome Resources: Vega_Trans:OTTDART00000006087 (1),  Ensembl_Trans:ENSDART00000062536 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC045936 (1) 1490 bp
GenBank:HQ450691 (1) 1444 bp
GenBank:CK236625 (1) 763 bp
GenBank:CF997420 (1) 740 bp
GenBank:BM104654 (1) 684 bp
GenBank:BM183599 (1) 669 bp
GenBank:CD594857 (1) 650 bp
GenBank:CD595303 (1) 650 bp
GenBank:BQ262378 (1) 638 bp
GenBank:AW233256 (1) 607 bp
GenBank:AI794126 (1) 553 bp
GenBank:BM104318 (1) 543 bp
GenBank:AI658128 (1) 528 bp
GenBank:CB355059 (1) 509 bp
GenBank:CB355590 (1) 502 bp
GenBank:BM403627 (1) 500 bp
GenBank:CD592956 (1) 334 bp
GenBank:CB360765 (1) 313 bp
CITATIONS (2)