Transcript

fgf8a-201

ID
ZDB-TSCRIPT-090929-6190
Name
fgf8a-201
Previous Names
  • fgf8a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022966 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022966|OTTDARG00000018834|ZDB-GENE-990415-72 fgf8a|OTTDARP00000019154 fgf8-001 LG_ CR925797.8 Danio rerio protein_coding KNOWN, 2238 bp
TCAGCGCGAGCGGGGTTGACATTGGAGACTGACTGGCAAT
GGGAGAAGAGGAGGGGATAAGAGAGTCCAGCAGCACTGCT
TCTTGAAGAAAGCTCATCAGATGCACTGTCCTGCCTCCTC
TGACTGACACTCACACAGGACTCACTGGATCAAACGTCAA
AGGATCTATTTGTGCTGCGCTCCTCACCTTCATGGACAGC
TCGGGATTTCCTCGGGCTGCATGATTACAGGCGCATCAGA
GGCGCTTTCGCTTAAACTTGAAAAGTAAATCGTTTACATG
CCGCGAGTTTTGCGTAAAGTGCACTTATTTGTTGTTCTCG
TTGTAATGAAGGAAATGCAGGTAGTGCATGTACTTGTCAG
CGGTGTCAGTCTGAAAAAAACCTTGGACATTTCTTTCTGC
TTCTGAGCAGCAACAGATCTTGTAATTTGCCAGTTGACCT
GTTCATCATATGTTGCGAGTCACAGTGTGGATACAAACGC
AGGACTTTACACATTTGAGCTGGAAAACCTGATATTATTC
TATATACACTTATTTTTAATCACTTTTTTACTGAGGCTAT
AAACATGAGACTCATACCTTCACGGTTGAGTTATCTATTC
CTTCACCTCTTTGCGTTTTGCTACTATGCTCAGGTAACCA
TTCAGTCCCCGCCTAATTTTACACAGCATGTGAGTGAGCA
AAGTAAGGTGACGGACCGGGTGAGCCGTAGACTAATCCGG
ACCTACCAGCTTTACAGCCGAACCAGTGGCAAGCACGTGC
AAGTTCTGGCCAACAAGAAAATCAACGCCATGGCCGAAGA
TGGCGACGTTCATGCCAAGCTTATAGTAGAGACGGACACA
TTTGGGAGTCGAGTTCGAATTAAAGGAGCTGAAACAGGCT
TTTACATCTGTATGAACAGGAGGGGGAAACTGATTGGCAA
GAAAAATGGTCTGGGAAAAGACTGCATTTTCACAGAGATA
GTCCTGGAGAACAACTACACGGCTCTGCAGAATGTGAAGT
ACGAAGGCTGGTACATGGCCTTCACGCGTAAAGGTAGACC
CCGCAAGGGCTCCAAAACCAGGCAACACCAGCGGGAAGTC
CACTTCATGAAGAGGTTGCCCAAGGGACACCAAATCGCAG
AGCACAGACCCTTTGATTTCATCAACTACCCTTTCAACAG
ACGGACTAAACGCACCCGCTACTCAGGAGAGCGTTGAAGA
GTGAAGCCAGAGAAAAGGAGAGGACCGAAAGCCAGAGACT
TTCTCAAACAATGAACTCCTCTTGTGGACTTCTTAACAAA
TTTTTGTACTGAGCAACAATATACCTAACCTTTAGTTTTT
TATGAATTTTCAGAAATAACAAAAATAAGGAGAGAAAAAA
AGTCTCAAGAAAAAAAAGAGATCTATTTTTGTACCCCTGA
CTTTTAGTACTGACCTGTGTAAGATTATAGGTAAGCGAAG
CACAGGATGTGTAAGCGCTGACATTTTAGTAGTACGTGGA
CTTCATCCGTCTATCCTCTCTCGTTCTGCTTTGATTTCGA
TGGTTTCCGAGTAATTTATAACTCTTCGTATTGCTGCTCA
AGGGGACTTGAAGGGCCTGAGAGAGAATGCACTGACAACA
CAAGGCTGTATTCGGTTACACAGGCAGCAGCCGGGGCACC
TCTCGACCACCCAGCGATAAGATACCCAGCTCATCTCTCA
GTAACCTCTCTGGTTCTTGATTCTGGAACTCTCTGGAGAT
AAACACGGTTAAAGCAAACAGAGCTTTAAATACATATTTA
AATGTGGCAGCTACATTTTTGATTATCGCAGGTTTCCTAC
CGTGGTTTAAACTGTAAATTCCCAGGTGTATAAATGCATT
GTATGGACTGTAGGAAAAAGCTTTTGTTCTTTGTTGCATT
TTGTTTGTCTGTTTTTTTATACAAATATAAATATATTTTT
ATTTGAGGATGTGTAAAATAATTTTAATGATGAAAATATT
TATTTAAAAACCTGTAATAAATTTACCTTAGGATACTGAT
GTCTTTTGCTTAATATGTTCCTGATTCAGAATTGCTTTCC
AAGCATTCTTTGTTCTGTGGAACAAAATGAAAAGTACATT
TTAAAAAAACACAATGAAAGTCTATGGGGTCCAAAATTTT
GACATTGATTATATGGTCAATCACAGAGAAATGCTTCAAG
ATTTCTTCATTTGTTTTCCAAATATGAAAGAAAGTGTTTC
TTTCCATCATTAAGCCTAAATGAAGATCTAAGATTCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations