Transcript

acat2-202

ID
ZDB-TSCRIPT-090929-616
Name
acat2-202
Previous Names
  • acat2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006058 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006058|OTTDARG00000005589|ZDB-GENE-990714-22 acat2|OTTDARP00000005409 acat2-002 LG_ AL929182.4 Danio rerio protein_coding NOVEL, 656 bp
GAGAAGTAGGACGTTCCGCAGTACAACCTGCATTCAGACA
GAGTCAGCCTACCAAGCACATAACCAACCTACCGGACAGC
AAAGATGAACACGGATGCGATTGTTATCGTTTCTGCCGCA
AGGACTCCTATAGGTCACGGGCAGAACCCTGCGCGGCAGG
CAAGTGTTGGTGCTGGTGTCCCATACTCAGTTCCAGCATG
GAGCTGTCAGATGATCTGCGGATCTGGCCTGAAGTCTGTG
TGCCTTGGTGCTCAGTCCATAATGACGAAAGAATCCACTA
TAGTGGTAGCAGGAGGCATGGAGAGCATGAGTCGGGCCCC
TCATATAGTGCAAATGAGGTCAGGGGTGAAGATGGGAGAT
GCTACTCTGCAGGACACTATATTGACTGATGGACTCACAG
ATGCTTTTTATAATTACCACATGGGAATCACAGCGGAGAA
TGTGGCCAAGCAGTGGGGGGTGTCCCGTGAGGCTCAAGAT
CAACTGGCTGTGACGTCACAGAACCGAACTGAAGCAGCTC
AGAAGGCTGGTTATTTTGACAAGGAAATTGTGCCAGTCAC
CGTTCCCTCTAGAAAAGGTCCAGTCGAGGTCAAAGTTGAT
GAGTTTCCTCGGCATGGCAGCAATATTGATGCTATGTCCA
AACTGAAGCCCTGTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations