Transcript

acat2-201

ID
ZDB-TSCRIPT-090929-615
Name
acat2-201
Previous Names
  • acat2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006057 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006057|OTTDARG00000005589|ZDB-GENE-990714-22 acat2|OTTDARP00000005408 acat2-001 LG_ AL929182.4 Danio rerio protein_coding NOVEL, 1938 bp
AGGACGTTCCGCAGTACAACCTGCATTCAGACAGAGTCAG
CCTACCAAGCACATAACCAACCTACCGGACAGCAAAGATG
AACACGGATGCGATTGTTATCGTTTCTGCCGCAAGGACTC
CTATAGGGGCATTTAATGGAACCCTAAGTAGTGTACCCCT
CCATGAACTGGGAACGCTGGTCATTAAAGATGTGCTGAAG
AGGGTCAATGTGAAGCCAGAAGAGGTCTCAGAGGTCATTA
TGGGACATGTCCTGACTGCAGGTCACGGGCAGAACCCTGC
GCGGCAGGCAAGTGTTGGTGCTGGTGTCCCATACTCAGTT
CCAGCATGGAGCTGTCAGATGATCTGCGGATCTGGCCTGA
AGTCTGTGTGCCTTGGTGCTCAGTCCATAATGACGAAAGA
ATCCACTATAGTGGTAGCAGGAGGCATGGAGAGCATGAGT
CGGGCCCCTCATATAGTGCAAATGAGGTCAGGGGTGAAGA
TGGGAGATGCTACTCTGCAGGACACTATATTGACTGATGG
ACTCACAGATGCTTTTTATAATTACCACATGGGAATCACA
GCGGAGAATGTGGCCAAGCAGTGGGGGGTGTCCCGTGAGG
CTCAAGATCAACTGGCTGTGACGTCACAGAACCGAACTGA
AGCAGCTCAGAAGGCTGGTTATTTTGACAAGGAAATTGTG
CCAGTCACCGTTCCCTCTAGAAAAGGTCCAGTCGAGGTCA
AAGTTGATGAGTTTCCTCGGCATGGCAGCAATATTGATGC
TATGTCCAAACTGAAGCCCTGTTTTGTGAAAGATGGCTCT
GGTACTGTGACAGCTGGTAATGCGTCAGGCATAAATGATG
GTGCTGCAGCTACTGTTCTTATGAGCCAATCAGAAGCCCA
GAGGCGGGGTTTAAAACCAATGGCACGCATCACTTCCTGG
GCTCAGGCAGGCCTTGACCCTTCAGTCATGGGCACAGGGC
CAATACCAGCTATTAGAAAAGCTATTGAGAAAGCCAGATG
GAAACTAGATGAGGTTGATCTGTTTGAGATAAATGAAGCA
TTTGCATCTCAGTCTATTGCCGTAGTACAGGATCTTGGTC
TAAACCCTGACAAGGTAAATGTGTGTGGCGGAGCGATCTC
TCTTGGTCATCCTCTTGGCATGTCCGGCTGTCGTGTGTTG
GTGACTCTTCTTCATGCTCTTCAGAGGACAGGCGGACGGA
AAGGAGTCGCCTCGCTGTGTATCGGCGGAGGAATGGGCAT
CGCTATGTGTGTAGAGAGAGAATAAGGGCAAATGAACACC
CTGTAATTTTGAGCTTTTAACCAGACTTTGAATCCAGCTT
TTCACATTCAAAACAGATATGAAAACATATGGTAAAACTT
AAGTATATATGCAGCGTTAATAGTAAGGAAACAGCCTGCA
GTAAAATGCACTCAATTCTGCCTTCTTATCTAAACTCATC
TCTAATGTTTCATCATATACAGTGGATCTGTTTTGCACTT
AACATGTATTGATTCTCTTCGGGTTTATGGTACATGAAAA
GGACTTGTTGAGGTATACCAGCTTTTAAGACATTCCCTTT
CTGTATAAATTGTTTACAGTTGCTGAGACACTCATGTAGT
AGAGCTTTTATTGGTACTAACAGTAGGCCTGTCCACATGC
GTGTTAGTTATGACCTGTAAGTCATATTGTGGTATTTATA
AATATTAAATTCATCAGTTGAATGGAGTCGGTCCTGTTTC
CAGCACCTTTTCCAGACCTGTCTACACTGTGCAATAGAAA
ACTGCCTTAGAGAATGTCAAATGTGCCAAAAAGTAAAATT
AGCCTCTATCCTGTGCTTCCATTAGGCTGCTTTTAACTCT
CTCTTCTCCTAATTAATACCTCAGGGGAAATGCTGTTTAC
TTATATAGCCCGTGTTGTACTCTTAATATCACTGCCTAAT
AAAGAACTTAATGAAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations