Transcript

wtap-202

ID
ZDB-TSCRIPT-090929-614
Name
wtap-202
Previous Names
  • wtap-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006054 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006054|OTTDARG00000005558|ZDB-GENE-030131-5990 wtap|OTTDARP00000005405 wtap-002 LG_ AL929182.4 Danio rerio protein_coding KNOWN, 1157 bp
GCGCACACGCTGGTCATGGCGGACGGGCTACCTTTCGTCT
AAATAAAAAACGCAACATTTTCCCTATCCCGAGAACTATA
TTAATAAAAATAACTCTTTCGTATCTCACATTGGAAGACA
TACGTGTCATTCTGGTCGAGGCGAACCGGCTCTGAGATCA
GAATGACCAATGAAGAACCTCTCCCGAAGAAGGTTCGCCT
TAGTGAATCTGACATGAAGACGCTGACTCGAGAGGAGCTC
TGTACCAGGTGGAAACAGCATGAAACTTACGTCCAGATGC
TTGAGGCGAAATATGCTGATTTAAACTCCAATGACGTGAC
AGGCCTGAAAGAGTCTGAGGAGAAGTTGAAGCAGCAACAG
CAGGAATCTGCACGCAGAGAGAACATTCTGGTGATGAGGC
TTGCTACAAAAGAGCAGGAAATGCAAGAGTGTACAACCCA
AATCCAGTACCTGAAGCAAGTCCAGCAACCGAGTGCAGCT
CAGCTGAGATCGTCCATGGTGGACCCAGCCATCAACTTAT
TTTTCCTCAAAATGAAGGCTGAACTGGAACAGACTAAAGA
CAAACTGGAGCAAGCCCAAAATGAACTGAGTGCCTGGAAA
TTTACACCTGATAGGTAAACTAAAATAACTCCCCCCTCCA
AACAAAAAGTCAAGACTTTCCTGATTCACCCCCACCTTCT
CCTCTGCAGGAGTGCAGATAATGGTGGGGGAAGACTGAAA
TGTGTTGCTCACAACGAGACTCAGACTTTAAAGCAAAAAA
GCTCAGAACAAAAGACATTTTTCTTTTGTATTGCCCTGCT
ATTACACATACCGTAATGTAAAATCAGAACAGAACACGGC
AGTTTGGTCAGGTGACACTTTTGTTTCAGCTCTTTCTCTC
CCCCCCACACCCCTCATGGTACAGAAGCCTGAAGGAATCG
GGACTGTTCCTGAAGAGGTGGTCACGTCGGAAACTCAGCC
CGTGTTAGAAAGCTTCCTGTAACAAATAAGGCGGCCTATG
AAAGACTTGAGCAAAGCGTTGGCTCTGGAGCTGGTTGAAC
TGTAGTTTGCAGGTCACTGATTGAACATTTAAAACATGAC
ATGGCCCAACTAAATGTGTTGCAGAGGAAAATGCCCCCAT
ATAAACTCCATCATAGATGCTTTGAGACTCTGGTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations