Transcript

wtap-201

ID
ZDB-TSCRIPT-090929-608
Name
wtap-201
Previous Names
  • wtap-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006022 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006022|OTTDARG00000005558|ZDB-GENE-030131-5990 wtap|OTTDARP00000005387 wtap-001 LG_ AL929182.4 Danio rerio protein_coding KNOWN, 2035 bp
ACGTGCTCCTCCTCCTCAGCGCTCGCGCGAACGAACACAC
TGATGCTGTGCGGCTGAACATCGCGCACACGCTGGTCATG
GCGGACGGGCTACCTTTCGTCTAAATAAAAAACGCAACAT
TTTCCCTATCCCGAGAACTATATTAATAAAAATAACTCTT
TCGTATCTCACATTGGAAGACATACGTGTCATTCTGGTCG
AGGCGAACCGGCTCTGAGATCAGAATGACCAATGAAGAAC
CTCTCCCGAAGAAGGTTCGCCTTAGTGAATCTGACATGAA
GACGCTGACTCGAGAGGAGCTCTGTACCAGGTGGAAACAG
CATGAAACTTACGTCCAGATGCTTGAGGCGAAATATGCTG
ATTTAAACTCCAATGACGTGACAGGCCTGAAAGAGTCTGA
GGAGAAGTTGAAGCAGCAACAGCAGGAATCTGCACGCAGA
GAGAACATTCTGGTGATGAGGCTTGCTACAAAAGAGCAGG
AAATGCAAGAGTGTACAACCCAAATCCAGTACCTGAAGCA
AGTCCAGCAACCGAGTGCAGCTCAGCTGAGATCGTCCATG
GTGGACCCAGCCATCAACTTATTTTTCCTCAAAATGAAGG
CTGAACTGGAACAGACTAAAGACAAACTGGAGCAAGCCCA
AAATGAACTGAGTGCCTGGAAATTTACACCTGATAGCCAG
ACTGGTAAGAAGCTGATGGCGAAATGTCGCATGCTGATCC
AGGAGAATCAGGAGTTGGGTAGGCAGCTTTCCCAAGGGCG
CATAGCCCAGTTGGAGGCCGAGCTTGCCTTGCAGAAGAAG
TACAGCGAAGAGCTCAAAAGCAGCCAAGATGAGCTGAATG
ACTTCATCATTCAGCTGGATGAGGAGGTGGAGGGCATGCA
GAGCACCATCCTGGTTCTGCAGCAGCAGCTGAGGGAGACC
AGGCAGCAGCTGTCTCAGATGAACCAAACCCAAGGCACTT
CTAGTGGAGCTGGCCCAAGCAGAACTTCCCCTTCAACAGC
CTCCGAACCTTCCACTCAGAGTGAACCAGCCAACGCCTCC
AGTTCAAATGTGGGGAAAGACTGCGGAAGGGTGTCCAATG
GACCCTCCAATGGGAACTCATCTCAGAGGGGTGCATCTGG
CTCTAGTTTGTACAGGGAAGCAAGCAGTGCAGATGAAGAT
TACCCTCCATCACCCTCTGTCTCCAGCCCCACCCATGATG
GCATATCAAAACTCTCCAACCACTCAGAAGATGCAGTGAG
CCAGAGGGGTGGAGAAGGGTACGTGACTCAGCTAAGTGCA
GGCTATGAGAGCGTGGACTCGCCTACAGGCAGTGAGACGT
CAGTGACCCAGCACTCGAACGATACAGACTCCAATGCTGA
CTCCCACGAGGCCGCTGCTGTCCCCAAAGGCAGCAGGACT
GCAGGTACGCGGCACAGCACTCAGAATGGCCTGGACTCAT
CTGCAGCAGCAGTTGCCACCAACACCTCCAATGCCTCTGC
AGGGTCTGTTTTGTAACATTCTTCTAGTTTCTGTTCATTT
TTTTTTTTTTTAAGTAACTCACAACAAATAAACAAAACAA
CCCGTCACACTTCAGGCCAGTTAGTTCTTGTTCAAGAAGT
GGTCAAAAGCATCACTTTTGTTTTGTACCCTCCTTCCCAT
CATAACCTATTTCAGTACATTTGCTACATGCTCGAAACTG
ATTACGTTTATAAAATGAGCAACACTGCGTTTGTATATTT
GATTTTTTTTAATGAGAGTTTTAAACCATTTTCCTCTGTC
GAAGTGATATAAACACTCGGTTCTGTACTGTTCATTTGCT
CACTTGCTAGAACTCTGAATGATTTAGCTATGTGTGATGT
ATCAATGCTCAAGTCTTGAAACTGCAAGTTCAGAGTCCTT
AGTTTCCTGATGTTGAACTTTTTTTGTTCCTCTACATGAC
GAGAGAAAACGTTTTTGTTTGACTTGTGTGTAGTTTTTCA
AGACGTATCTTGTTAAATTCTGATTTCGATCCTTTTCATG
TACTGACCAAATATCAATAAAGAGTTTTAATATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations