Transcript

sv2c-201

ID
ZDB-TSCRIPT-090929-5907
Name
sv2c-201
Previous Names
  • sv2c-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022585 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022585|OTTDARG00000018576|ZDB-GENE-060526-233 sv2c|OTTDARP00000018900 DKEY-18P14.1-001 LG_none BX294131.7,CR854913.13 Danio rerio protein_coding NOVEL, 2238 bp
ATGGATGAAACAGCTCCACAGGACACGTCTTCCCTCATGA
AGGGGGCCAGAGACATTGCTAAGGTGGCCAAAAAACAAGC
CGTCAAGAAAGTCAACAAAGTTGTGGATCGAGCCTCAGAC
GAATACTCCCAAAATCGAGCCTACCAGCGCTTCCAGGATG
AAGACGACGACTACTACAGCCAGCCAGATGGCAACTACAC
CAGCCACCAGGCTAATGATGAAGAGGGATCCAGCGATGCT
ACCGAAGGCCACGACGATGAGGATGAGATATACGAAGGGG
AGTACCAGGGGATCCCGTCTGATGCAAAAGCCAGAGACGG
GCAGGTGGCTCTGGGACAGCCACTGTCGGATGGCCTAAAG
GACCGGAGAGAGCTGGAGAACGAGAGACAGGCGGATGAGG
AGGAGCTGGCGCAGCAGTACGAGCTCATCATTCAGGAGTG
TGGACATGGCAGGTTTCAGTGGCAGCTCTTCTTCACGCTG
GGGCTGGCGCTCATGTCAGATGGCGTGGAGGTCTTCGTTG
TGGGCTTCGTTCTTCCCAGTGCCGAGACGGATATGTGTGT
GCCTGATTCAAGCTCTGGATGGCTGGGAAGCATTGTGTAT
CTGGGCATGATGGTTGGCGCCTTCTTCTGGGGCGGCATGG
CTGATAAGGTGGGCAGACGGCAATGTCTGCTCATCTGCAT
GTCCTTAAATGGCTTCTTCGCCTTCCTGTCATCTTTTGTG
CAGGGCTATGGGCTCTTCCTTCTCTGCCGTATGATTGCTG
GCTTTGGGATTGGTGGAGCGGTGCCCATCGTCTTCTCGTA
CTTTGCTGAGGTGTTGGCAAGAGAGAAGCGTGGCGAGCAT
CTGAGTTGGCTCTGCATGTTCTGGATGATTGGAGAGATTT
ATGCCTCCGCCATGGCCTGGGCCATCATACCTCACTACGG
TCAGATAACCACAGCATCATCACAGTTTATTAATTATCAC
CATTATACAAGCTGGAGTTTCAGTATGGGCTCTGCTTATC
AGTTCCACAGCTGGAGGGTGTTTGTGGTGGTTTGCGCTCT
TCCATGCGTTTGTGCTGTCGTGGCCTTAACCTTCATGCCG
GAGAGCCCACGCTTCTACTTGGAGGTGGGGAAGCACGACG
AGGCCTGGATGATCCTCAAGCAGATTCATGACACAAACAT
GCGAGCGCGTGGACAGCCAGAGAAAGTCTTCACCGTGAAC
AGAATTAAAATCCCGAAGCAGATTGATGAGTTTGTCGAGA
TGCACGAATCGGGCAACTTTTTCTCAAAAGCGATCTTCAG
AATAAAGACAGAGCTTCATGGGATTTGGTTGAACTTCTTG
AAGTGTTTTAATTACCCAGTGAAAGAGAGCACAGTGAAGC
TTGCTATTGTGTGGCTTACACTGTCGTTTGGGTATTACGG
TTTATCTGTGTGGTTTCCTGACGTCATCAAACACCTTCAG
AACGATGAATATGCCTCTAAAGGACAGCGGCATAACAACG
AGCGCATTGAGGACTTCACCTTCAATTTCACCCTTGAAAA
CCAGATACACACTAATAGCTTATTCATCAACGACAGGTTC
ATAAATATGAAATTCAAGTCTGTCACATTCATCAATTCCA
CCTTTCAAAGCTGCTTTTTTGAGGATGTGACATCCGTTGG
ATCTTTCTTTCGTAACTGCACATTTATAGAGGCTGTCTTC
TACAACACTGATATTGACGATTCCAAACTTAAGAACACAG
ATGTTATAAACAGTACATTTTACCACAACAAAACAGGCTG
TCAAATGACTTTTGAGGATGATTACAGTGCATACTGGGTC
TACTTTGTCAATTTCTTGGGAACACTAGCTGTTCTGCCTG
GCAACATTGTTTCTGCACTGCTCATGGACAAAATTGGCCG
CTTGTCTATGCTAGGGTTTTCCATGATCCTGTCAGGTATC
AGCTGCTTCTTCCTGTGGTTTGGCACCAGTGAGTCGATGA
TGATTGGGATGCTGTGCTTGTACAATGGCCTAAGCATTTC
CGCTTGGAACTCCCTGGATGTTGTGACAACAGAGCTGTAC
CCTACAGACAGAAGAGGAACCGGATTTGGCTTCTGTAATG
CATTGTGCAAGCTGGCAGCGGTCATGGGGAATCTGATTTT
TGGATCTTTAGTGGGCATCACCAAAGCCATCCCCATTCTT
CTGGCATCCTCGGTGCTCGTCGGTGGAGGTCTGGTGGGAC
TTCGACTGCCTGACACCCGCTCTAATGTCCTCATGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations