Transcript

isl1-201

ID
ZDB-TSCRIPT-090929-5901
Name
isl1-201
Previous Names
  • isl1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022579 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022579|OTTDARG00000018571|ZDB-GENE-980526-112 isl1|OTTDARP00000018894 isl1-001 LG_ AL954694.14 Danio rerio protein_coding KNOWN, 2303 bp
AGAGAGGGAGAGAGGGATAGGGACAAGAGTGGCCCATCAA
TACAGTGACCAAACACCGGAGCTCAACACACACCCCTAAC
TCTAATCGCAAGCATCTCGATTTCGGGAAGTCCTGCAACA
CCTCGAACCCTCGGCCACTTTCCCACCTTCACAGATAAAA
ACACGGGCACTAAGGGCCTTCTGTCCGGTTTTAAAAGTGG
ACCTAACACCGCCTTACTTTCTTGACATGGGAGACATGGG
GGATCCACCGAAAAAAAAGCGTCTAATCTCGTTGTGTGTC
GGCTGTGGGAATCAAATCCATGACCAGTATATTCTGCGCG
TGTCGCCGGATCTGGAGTGGCACGCGGCGTGTTTGAAATG
TGCAGAATGTAACCAGTATCTGGACGAGTCCTGTACATGT
TTTGTGCGAGACGGGAAAACTTACTGTAAACGGGACTACA
TCAGGTTATACGGGATCAAATGTGCAAAATGCAACATCGG
TTTCAGCAAGAATGACTTTGTGATGAGAGCACGTTCGAAG
GTTTATCATATTGAGTGTTTTAGATGTGTGGCGTGTAGTC
GGCAGCTCATCCCAGGAGATGAGTTCGCTCTGCGGGAAGA
CGGGCTCTTCTGCAGGGCCGACCATGACGTGGTGGAGCGG
GCAACAATGGGTGCTGGTGACCCATTAAGCCCATTACATC
CGGCGAGACCTTTACAAATGGCAGCAGAGCCCATTTCGGC
ACGTCAGCCTGCGCTTCGACCTCATGTGCACAAGCAACCT
GAGAAAACAACCCGCGTCCGGACAGTCCTCAACGAAAAAC
AGCTCCATACCTTGAGGACTTGTTACAATGCCAACCCTCG
ACCCGACGCCCTCATGAAAGAGCAGCTCGTTGAGATGACG
GGTCTTAGTCCGAGAGTCATCAGGGTTTGGTTTCAAAACA
AGCGCTGCAAGGATAAAAAGAGGAGCATACTGATGAAGCA
ACTCCAGCAGCAGCAACCCAACGACAAAACGAACATCCAG
GGGATGACAGGTACTCCAATGGTGGCGACCAGTCCAGAGA
GACACGACGGTGGTTTGCAGGCAAACCAAGTGGAGGTGCA
GAGTTACCAACCGCCTTGGAAAGTCCTAAGTGACTTCGCA
CTGCAGAGTGACATCGACCAGCCTGCTTTCCAACAACTGG
TTAATTTTTCTGAAGGTGGTCCAGGCTCAAACTCCACAGG
GAGCGAGGTCGCGTCAATGTCCTCGCAACTGCCAGATACA
CCAAACAGCATGGTAGCGAGTCCTATAGAGGCCTAGGCGA
GTGGATTATCTCCTGCATCTGAAGTTTGCGAAAGGACGTG
TCCGGGAACCAATCTCAGAGAGAGGCTCGTGAAGTTTCTT
CCATCCCTATTTCATTTAGGGCCGCTTCTGAATAAAAGCC
CATCCTCCGACTGCACGAGGCCTCTATATCGAAACAACCT
TTGGTTGTATTTATACACTGTGATGACAATCGTGGGATTT
AAACACACTCTGACCGGGCAAGTCCAACGAGTGTTGCGAA
AAGACCATTTAAAGTTGCAGACTCCAGCGAAAGTGGACCC
TGCCGGCGCACATATTCACATACCGAACCTGACATGATCA
TTGCAGTGCTCCGCGGCCGAGTGGACCTGGTCGGCTACAC
TTTTGCCAAATACCCCTCCACACTTTTCCCACTTTTATGA
CAAATCAATGGACCTCTACGGATATAAGACGCAAGAGAAC
TTAGTCTAATATATTCATTCATATATAGTCTACTTCTGTG
CGCAACGTAAGTAGCCTATAATGAAACCATGACTGTTTAT
TCTGTTTCTATAAAAGATCGAGACGGACTATACTTGCTCA
CAAATAAGGGTATGGCAGCCGAGGTCTACTGCGATTACAG
TTTTGTTATATGGTCTCTTTTGAAGCCCAAGTACTAAGGC
ATTGCAACAAGGTATACCTCTATTTTGCCACAAGCTGTGT
GGGAATTTCATGTGTTCGTGTCCGTCCAAGAAGTTTTTTT
TCTTTCCCAAAGATGTGTATAGGTTTAATTTAAGTTAATA
TGACTGACTAGTTCTGGAGGTTTTGTTTCGTTCCTGTATT
ACAAAATATTTTATTATTTATTGTCAAAAGACATGCCACT
TTTGTGTACTTTTACTTGCTGAAGAAGTAAAAAAGGAGGA
AAAGAATATTGTCGACTCCGAATGATCTATCATAAATTGA
CGTGTCCTGTCGTTTGATCAAAGACTGATGTAAGAACAAC
GCCATATGTAGAGTTATCTTCAGGAAAATCTTGATCAATA
AAAATCTGACGTGTACTGTAAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations