Transcript

eral1-002

ID
ZDB-TSCRIPT-090929-5816
Name
eral1-002
Previous Names
  • si:ch211-207c6.1-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022470 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022470|OTTDARG00000018500|ZDB-GENE-060526-84 eral1|no_translation CH211-207C6.1-002 LG_ BX548073.8 Danio rerio protein_coding NOVEL, 810 bp
ATTTCACTCGACTGAAGCAACATGTCTGCGCCCTCAACAC
ACGCGAAAACAAACATGGAGAGTACAATAACCTTGCACAA
GAGTTAACTTAATTGAAACCCCGTATAAACATCCATTTTG
TGTAGAGAAAGCTGATTTCAGCGATGACTTTGCGGAGCTG
CGAGACGTTTTTACGCAGATCTCTGCGATTCTCGACGGCC
CTCAACTTGACAGCATTCCCCGAGCACGAGCAGCTGTATC
TGCGTGTGTCATCAGGTTGCTCAGTATTTCGTCCACAGAC
AGTGAGGAAATGTCTCTTTCACTGGACCCCGGCCTGCACG
GTGTCCCAAGGTGTCTTTTTGGACAGACTTCAGAAGGGAG
CTGCTGTGACTGACGAGAGTCTCTGTAATCAGCCAGTGTC
TGTTTCACCAGACAGAGCCCAACAGTTTTCCTTATTAATG
AAAGATCCTGATCAACCTGAAAATGCCAAATCTCTTAAAG
TTGCAATAGTGGGTTCACCGAATGCAGGGAAGTCCACACT
GACGAATCAACTGCTGGGTCGAAAGTTGTTTGCTGTTTCA
TCAAAAGTGCACACCACAAGATCACGTGCTGTTGGTGTCC
TGACAGAGAATGACACTCAAATTGTTTTGTTGGATACCCC
TGGTCTCACCACACAGATAAAAGCTAAAAGTTGTGATATA
TTTGTTTAACAGACACCAGCTGGAGAACTCGCTCTTGGTG
GATCCATTTAAGTCACTAAAGGAAGCTGATTTAGTGGTGG
TGTTAGTTGACGTGTCTGATAAATGGACCCGCAGTAAGCT
GAGCTATGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations