Transcript

eral1-201

ID
ZDB-TSCRIPT-090929-5815
Name
eral1-201
Previous Names
  • eral1-001
  • si:ch211-207c6.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022469 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022469|OTTDARG00000018500|ZDB-GENE-060526-84 eral1|OTTDARP00000018825 CH211-207C6.1-001 LG_ BX548073.8 Danio rerio protein_coding NOVEL, 1754 bp
CGACTGAAGCAACATGTCTGCGCCCTCAACACACGCGAAA
ACAAACATGGAGAGTACAATAACCTTGCACAAGAGTTAAC
TTAATTGAAACCCCGTATAAACATCCATTTTGTGTAGAGA
AAGCTGATTTCAGCGATGACTTTGCGGAGCTGCGAGACGT
TTTTACGCAGATCTCTGCGATTCTCGACGGCCCTCAACTT
GACAGCATTCCCCGAGCACGAGCAGCTGTATCTGCGTGTG
TCATCAGGTTGCTCAGTATTTCGTCCACAGACAGTGAGGA
AATGTCTCTTTCACTGGACCCCGGCCTGCACGGTGTCCCA
AGGTGTCTTTTTGGACAGACTTCAGAAGGGAGCTGCTGTG
ACTGACGAGAGTCTCTGTAATCAGCCAGTGTCTGTTTCAC
CAGACAGAGCCCAACAGTTTTCCTTATTAATGAAAGATCC
TGATCAACCTGAAAATGCCAAATCTCTTAAAGTTGCAATA
GTGGGTTCACCGAATGCAGGGAAGTCCACACTGACGAATC
AACTGCTGGGTCGAAAGTTGTTTGCTGTTTCATCAAAAGT
GCACACCACAAGATCACGTGCTGTTGGTGTCCTGACAGAG
AATGACACTCAAATTGTTTTGTTGGATACCCCTGGTCTCA
CCACACAGATAAAAGCTAAAAGACACCAGCTGGAGAACTC
GCTCTTGGTGGATCCATTTAAGTCACTAAAGGAAGCTGAT
TTAGTGGTGGTGTTAGTTGACGTGTCTGATAAATGGACCC
GCAGTAAGCTGAGCTATGAGGTGCTGAAGTGCCTGGCCCT
GAATCCAGATGTCCCTGCCGTCCTTGTCCTCAATAAGGTG
GACTTACTGAAGAACAAAGCGCTGTTGTTGGACATCACGG
CACAGCTGACAGAAGGCATGGTGAATGGAAAGAAGATCAG
AATCCATGGCGCATCAAAACCAGTGCGGAAAGCAGCAGCC
GGAGCCAACAGCAGACTTAAAGAAAAAAAAGCTGCTGGGA
GCCTGGAGGACGAGGCGGATCATGAGGACAAGCTGAAGGC
CCTGAAGAGCCACGGGGGGTGGCCGCATTTCAAAGACGTT
TTCATGCTCAGTTCTATTGACCATGAAGATGTGGAAACAT
TAAAGAGGTACTTGTTCGTAGCTGCAAAGCCTTGCCAGTG
GCAGTACCACAGTGAGGTCCTGACAGATCAGAGTCCTGAG
GACGTGTGCTTCAATACCATCAGAGAGAAACTACTGCAGA
ATCTCCCTAAAGAGGTGCCGTACACTATGACACAGGAAAT
TGAAGTCTGGAAGGAGTCTGAGGATGGGGTGCTCGACATA
TCCATCAAACTGTATGTGCAAAAGGAAACCCATATGAAAA
TGGTTATCGGTCCTGGAGGTCAGCTGATAACCAGAATAAA
CCAGGAAGCTGGAAATGACCTGATGAAGATTTTCTTGTGT
AATGTGCGCTTAAAAATCTCGGTGAAGTTGAGGAAGTGAA
GTTAACTCTGTTAACTCTTCAGATGACAGGTCATAGCCTG
ATGCATAAAGAAGGACACAGAAACCTTAAAAAAAAGAGAT
ATTTAAGAGTGAAGAAATGGACAAGAACTCAAAATATCTC
TACTTATACAAGATATCAACAGATGTTCTCAAATGAAATT
CAAGTTTGGCATATAACATGGTTTTCTGTTTAATTTTAGT
TGCAAGACTGCCATTTGTTTTATTAACAATACTGGGATAC
CATCTGCCTATGCAGTTTTATATGTCACTGCTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations