header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5805
Transcript Name: si:ch211-204c21.1-202
Previous Names: ottdart00000022459, sb:cb458-002, si:ch211-204c21.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022459 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022459|OTTDARG00000018494|ZDB-GENE-030429-35 si:ch211-204c21.1|OTTDARP00000018817 CH211-204C21.1-002 LG_ BX276099.7 Danio rerio protein_coding NOVEL, 1230 bp
AAGGCTTGTCTCTTCAAGCTCCATCAGGATCTTCTCTGTG
GAATCAGCCGCTCGCTTCTATCTTCAGCGTCTCCCAGCCC
TTCACTCAGGCTCCAGTCTTCTCCTCTTCTCCTGGCTCTG
TCTGGGCAAATGCTCCTGCAGGTTTTGGATCCTCCACCGT
TTCCCAACAGCTTCCATCATGGAGTGCCGCCCCAGTTTCC
AATGGATCCAATGGTTCTTGGAGCCCTCATCCAACTCTGG
GAAACCCATTCCAAAGCAGCGTATTTCCAGATGGACAGCA
GAGCTCCAGTCCTCCTCCACTGGTTCCCCCGCGGCCAGTG
GCCACCAAAGAAGCTCCAAAGGTGGACAGTAACGCTTTTG
TTGACTTGGATCCTCTAGGAGAAAAGGAGAAGAGAGATAT
CAAGGACATGTTTAAGGATTTCCAGATGGCCAAGCCACCA
AATGTGCCAGCAAGGAAAGAGCCATTGAAAATTGGAGGTC
AGAACCCATTCGACAACTCCTATGGAAAAGATCCGTTTGG
CACATCTGTACCTGCAACTAGCGCTCCTCCCATAAAAGCA
GTGGGCTTAGATTCTTTCAGAGACCCATTTGGAAACCCAT
TTGCATGATAGCCGTTCACCCTGATGACTCCATAGGGTCC
AAACTAAAAGAATCATTGAACAAGAAATTATGCAAAAGCA
ATTCCATCCCAGATGTTTCTTACAGCTTTATAATGTTTTG
GATACAGCAGCACCGGTTTTATGTAGCTTTTCCACTAAAG
TGCATCCCGTTGAAGAGCAGGTCTCTTAGCTCTGATGTCA
CAGCCAAATCAAGCGTCTGCAAACCTCCAGCTTTTATAAA
CCAGCATCACATCTGTATGTTGGTTGAGGACAGGCTGAAA
AGAAACCATCATCCAGTTATGGTTTCCTGCTAAAACACGG
ATTTCACTGCAGTTTGCCTGTGAATGACAACATGGTCATT
CATGGAGTGGTTTTGTTTTCTGCACTAAAAGCACTCAGAA
ACAATTTAGTCACGTCTCCTTTGAGGACTTTTTCTATATT
GCAGTATTATATATTGACTTTGTGTTTACTCTTCCACATT
TATCGAAAGCTTTAGGGCATGCGATTGGTCACTACTTTTG
ACAGATGAACAAATTCCATGTTTTTGTTTGTTTGTTTAAA
TCCAGTTTAAAGGGTTAGTTCACTCAAACATTTAAAACGT
GCTATTAATTATTTAAACTCAAGTCGTTCC

si:ch211-204c21.1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:ch211-204c21.1-201 (1)    Ensembl 1885
si:ch211-204c21.1-202 1230
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-204c21.1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000022459 (1),  Ensembl_Trans:ENSDART00000147252 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CD597194 (1) 650 bp
GenBank:CD597011 (1) 500 bp
GenBank:CD583909 (1) 339 bp
CITATIONS (2)