header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5804
Transcript Name: si:ch211-204c21.1-201
Previous Names: ottdart00000022458, sb:cb458-001, si:ch211-204c21.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022458 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022458|OTTDARG00000018494|ZDB-GENE-030429-35 si:ch211-204c21.1|OTTDARP00000018816 CH211-204C21.1-001 LG_ BX276099.7 Danio rerio protein_coding NOVEL, 1885 bp
TAAGGAGCACTGGCTGACACGAATCGTGTGTTGTGTGATG
CTCTGGACGCAGTGAAACCGGTCTTTAGAGGGTTAAATTT
CACTTTGAGGGGGAGTTACCGAATCTGCAGTAACATCGGA
GCGCATTCCAGAGAGCTGCCAACATCCCGGGAATAAGACC
TTCAGCGTCAACATCTCACAGCCACATCACGGGAATATAC
CGCACTACCGGCCACGCGTCGACTGTCTCGTCAAGCCGCG
TTTTCTCCGCCGGTTCGGAGTATGCGAGCTCCGCTTACTG
TCTCCACGTAGGCACAGCTGATGATGGTTCACTGCTGAGT
CCAGCTGCACAGAGGAGAGAGTGAGAGAGTGCTGATCCTG
AACTGATTCCGTCTTCACACCCGCTGCATGCGCACAAGGC
TGGCCTCCAAACATGTCTGCAGAAGTGGAAACCAGCACAC
CTCCGGTCGAGCAGCCACCTTTTAAGACGCCCTCCAAAAA
AGAAAAGAAGAAGGCTGCAGCGAGTCCAGAGAAAACAGAT
GAGTTTCTCCTAGCCAGGTTCAAAGGTAATGGAGTTCGCT
ACAAAGCCAAGCTGATCGGTGTAGATGATGTGCCTGAAGC
AAGAGGAGACAAAATGAGCCAAGACTCTATGATGAAACTG
AAGGGCAAGGCGGTGGCAGCTCGCTCTCAGGGCAAGCACA
AGCAGAGAGTCTGGGTGAACATCTCTCTTTCGGGAATCAC
TGTCACTGATGAGAAAACTGGGGCAGCAATACTGGAGCAT
GCAGTAAATAAGATCTCCTTCATAGCCCGGGATGTCACTG
ACAGCAGAGCTTTCGGCTACGTGTGTGGCGCGGAGGGCCA
GCACCAGTTCTTCGCTATTAAAACAGCACAGCAGGCGGAG
CCTCTTGTCATTGACCTGAAGGATCTTTTCCAGTTAATCT
TCAATATGAAGAAAAAAGAAGTCGAGGGGTCGAAGAAGGA
TGAAAATAATAAAGTGGTGGAGAACGGCAGCGAAGGCTCG
CACAATGACAGAAAAGGCGTTGAACAGCTGGACTTGTTTG
GAGACATGTCGACCCCACCAGACTTAAACTCTCCCTCGTC
AGAGGACATCCTACTGATGGATCTGTCCACCGAGATAGAC
AGCAATCAGAACTGCGTTAAAGGAAACCCGTTCACCTCGT
CTTGTGTCTCCAGAGCCCAGTCCAGCCTCACGCCTGAGAA
CCCCTTCACCTCTCAGCTCAGCTTCTTCCCCACCCCGATC
CATGACCCGTTCAGCGACGACCCATTTTACAAAAAAAGCG
ACGACCAATCGATCCGGGATGACCCCGCCAACCACAGCCC
TAATAGCTTGTTCAATGGTGGCCCTAAAAATGGTGACTCG
GACTATTTGGGCCAGCAGTTTGACCAGCTCTCCAACAGAA
CGGTCATTCAGGCCCTCAGTAATGGCCAGTGGCCGGTAGA
CGGCAGAGCTGGAGAAACCACTAACTGGACTCAAAACACC
GTCCCGGTTCAAGAGCAGAATGGACATGGGAACGGGATGC
CAAATCCGTTTGTGGAGAAGATGCAGAATGGAGTGAAGCA
TGAGAACGGAGGGACTGAAGAGTCGCATGTCCATCAGGCC
AAGGATTCTGTCATTATTTGCCCTCCACCACTCAATATGA
AGGCTGGAAGAGGCAGGAGGAGTGTAAAGTCTCCTTCAAA
TGAAAACCTTGGAATGGCTTCATTTGTTTCAGCAGAGCAG
TCTGAATCTCCACCTCCTCCACCTGAGAGCTGCTCCGTCA
GCAGTCTGTTCAGCAGGAGCCCTTCCTCCACAGACACACT
CACAGATCTGGAGTACTTGGTGACCAGGGAGTTGAAAACG
TGGACATTGCGCGTTGCATGTTCTCAGTACGAGGAACTGG
TCGAG

si:ch211-204c21.1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:ch211-204c21.1-201 1885
si:ch211-204c21.1-202 (1)    Ensembl 1230
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-204c21.1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000022458 (1),  Ensembl_Trans:ENSDART00000142271 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CB333826 (1) 639 bp
GenBank:CR927042 (1) 539 bp
GenBank:CR927842 (1) 491 bp
GenBank:CD597889 (1) 335 bp
CITATIONS (2)