ZFIN ID: ZDB-TSCRIPT-090929-5778
Transcript Name: znhit1-201
Previous Names: znhit1-001, zgc:112524-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022431 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022431|OTTDARG00000018473|ZDB-GENE-050417-272 znhit1|OTTDARP00000018796 CH211-271E10.4-001 LG_ BX640523.14 Danio rerio protein_coding KNOWN, 1009 bp
AGTAGAAGAAGAGTGGTTGTTGTCGTCTTAAACTTCCGGG
CATGGCGGAGAAAAAGATAGCTGTTCGCTCACAGGACCCG
GGCCAGCGGCGGGTGCTGGACAGCGCTACGCGGCTGCGCC
GTTTGAGCAGACAGCTCGAAGCGCTCGAGAAAGACAATTT
CCAGGACGATCCTCACGCGAGTCTCCCGCAGCTTGTCAAG
CGGCTGCCGCAGTTCGACGAGAGCAACGAATCCGGCAAGC
GGAGGAAGAAGACGAGGGGGGACCATTTTAAACAGAGGTT
TCGCAAAAACTTCCAGACTCTTCTAGAGGAGGAGGACTTA
AGTGTTAGTGAGGGTCCAAACTATCTGACTGCCTGTGCGG
AGCCTTCTAAGATTCCTCAGCGTCATTTCTGTGCAGTGTG
CGGCTTCCCTTCAAACTACACCTGTGTGTCGTGTGGTGCT
CGCTACTGCTGCGTCCGATGTTTAGGAACACACCATGAGA
CCAGGTGTCTAAAGTGGACAGTTTGATCTGGTTTGACGGT
ATGAACAGAAGTAAAGCACGCTTGTGGATCATACAACAAT
TTTACAAACTTATATTCCTTGTATAACTTATATTCCAAAG
TCATTACAGCCACTTGCTCACACACAATAAACACATGTAA
GTAAGTAAAATAACTACCTTTCATCCCGGCATTTCAGTTG
AAATTTTATATATTTGTATTAAATGGATAAATCTTTTGGC
AGAGTAATGAGTAGCTGTTGAAGTTTTCAGTGGCGAGTAA
GCTTTGGCTCTGACATATTTAAAGTAGCAGAGTGAAAAAC
TGCAATTTAAGTATTTTCAGAGTAAATGACTTCACTTGGC
AGAAAGAAAAGTTGGATGGTGGTAGCACTACGCACCCAGT
ACTAGAGTTTATGAACATTGTTTTGTAAATATTCTTAAAA
CATTTGTATGTTAATATATGTACATAATTGTTTATGCTGT
TAGACAATTTTGTGTTCTGGAACAAATAAATAACTAGAAG
TTGTAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znhit1-201 Contained in:
[BAC] CH211-271E10 (1)

Genome Resources: Vega_Trans:OTTDART00000022431 (1),  Ensembl_Trans:ENSDART00000076800 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC093363 (1) 1023 nt
GenBank:BC067648 (1) 1005 nt
GenBank:CD754821 (1) 898 nt
GenBank:CO919524 (1) 866 nt
GenBank:CK146605 (1) 810 nt
GenBank:CD751216 (1) 749 nt
GenBank:BI710281 (1) 592 nt
GenBank:BI325550 (1) 584 nt
GenBank:AI943358 (1) 484 nt
CITATIONS (2)