Transcript

dlb-201

ID
ZDB-TSCRIPT-090929-5699
Name
dlb-201
Previous Names
  • dlb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022344 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022344|OTTDARG00000018419|ZDB-GENE-980526-114 dlb|OTTDARP00000018729 dlb-001 LG_ BX005407.5 Danio rerio protein_coding KNOWN, 3030 bp
ATCAAGACGAACCGCACGCGCAGAAGAACGACGAGGACAA
GTGCGCTTTTCCTATGAAGACTCACTGGACTTTCATGGAC
GTGCCGAGGATTTCTTACAAGGACATCTAACTTTTTTCCT
TTCTTTCTTCATCTCCAAGCACTTTAAAACTTGGGAAGTA
ACGAATGAAGATACTTGCGCCTTTTTGTAGTAAAGTTTAG
GATAAAGTGAGCGAGATGGCGCATCTGTCTTTGTACTGCC
TGCTGTCTGTGTCGCTGTTGCAGTTGGTGGCTTCGTCGGG
TGTGTTTGAGTTGAAAGTTCACTCTTTCAGCACCACACGG
CGCTTCTGCAGGAGGACGCGAGACTGCAACATCTTTTTTC
GGATTTGTCTCAAGCATTCTGAGGACGTGATCTCCGCAGA
GCCTCCGTGCACCTTCGGAACCGGTCAGACCAGCGTCCTG
CGAGCGGACCAGAGCTCCATAGCCAGCAGCGCTGCCATCC
GGGTGCCTTTTCACTTCAAGTGGCCGGGGACGTTTTCTCT
CATTATTGAGGCATGGAATGCAGAATCGCCCAAAGAGCAT
CATGATTACACAGAGAATCAAAACAACCTGATCAGCCGCT
TAGCAACACGAAGGCGCTTGGCAGTTGGGGAAGACTGGTC
TCAGGATGTTCACTTTGGCGATCAGAGCGAGCTCCGTTAC
TCGTATCATGTGTTCTGTGATGAGTTTTACTTCGGCGAGG
CTTGTTCAGATTACTGCCGTCCTCGTGACGACACGCTTGG
CCACTATACCTGCGATGAGAATGGGAACAAGGAATGTTTG
GTGGGATGGCAGGGAGACTACTGCTCTGACCCCATCTGCT
CTTCAGACTGCAGTGAACGACATGGTTATTGCGAGTCTCC
CGGAGAGTGCAAGTGTCGTCTGGGGTGGCAGGGGCCTTCC
TGCAGCGAGTGCGTTCATTATCCTGGATGCCTGCATGGGA
CATGTTCACAGCCATGGCAGTGTGTGTGTAAGGAGGGTTG
GGGAGGCCTCTTCTGTAACCAGGACCTCAACTACTGTACC
AATCACAAACCCTGCGCTAATGGCGCCACCTGCACCAACA
CTGGACAGGGCAGCTACACTTGCACCTGCCGGCCGGGATT
TGGAGGCACAAACTGTGAGCTGGAGATTAATGAGTGTGAC
TGCAACCCCTGCAAGAATGGCGGCAGTTGTAATGATTTGG
AGAACGATTACTCTTGCACGTGTCCTCAGGGATTCTACGG
GAAGAACTGTGAAATCATTGCCATGACCTGTGCAGATGAT
CCCTGCTTTAATGGAGGCACATGTGAGGAGAAATTCACCG
GTGGCTACGTCTGCCGATGCCCACCGACTTTTACCGGATC
CAACTGTGAGAAGAGACTGGACCGCTGTAGCCACAAACCA
TGTGCCAACGGTGGTGAATGTGTGGATCTGGGTGCCAGTG
CTCTTTGCCGCTGTCGCCCTGGTTTCAGCGGCTCTCGCTG
TGAGACAAACATCGACGACTGTGCCCGCTATCCCTGTCAA
AATGCTGGAACCTGCCAAGATGGCATTAACGACTACACCT
GCACTTGCACGCTGGGTTTCACTGGTAAAAACTGCAGCCT
GCGAGCAGATGCTTGTCTTACGAACCCATGCCTCCACGGA
GGAACATGTTTCACTCATTTCTCCGGGCCAGTGTGTCAGT
GTGTGCCCGGCTTCATGGGTTCCACCTGCGAGTTTCCAGT
GCAGGCCAGTCTGGAGAAGATGGCGCCAAGAGTTGGGCAG
ACTTCGCCCTCGGCTGTGGCGGTGTCATGTGTGTTAGGAG
TGCTGGCTGTGTTTCTGGGAGTGTGTGTGGGACTGGTGGT
GCTCAGAAGGAGAAGGCATAGACTGCGCAGACAGCAGCTG
TGCGATTCCGTGTTTAATGATTTGGAGACGGTGAATAATT
TAGACAGGCAGCACTATCCCTATGACAGAGACTTCAGTCA
GGTGAAACCCTGCAACACCGAGGGCAGGATCTCTTTGGCT
GCATCTCACACGCTCCCTGCTGGGCAAGAGTTTCTGTGGA
GTGCTGGAGGAGGGCTTAGATGAGATGTTTTAATGCCTAA
ACAACACACAAACACACTCATGCATACACAAATATCATGA
ATACAAAAACTCGCATGCAGGGATGAGAATTTGGATGTAG
CACTTGCTTTTGTCTTAATTTTTTATGAATGAATGAGTGA
ATGAATGAGGGATGTGTTAACCGAATAAGGGATTGGACCT
TTGCCATCTGTATAGGTGGAAGACTGTAAACCAAAAACCA
AAAGAGACCAACACGCACACCTCTGTGTGAATCTGTTTCC
ATATGAAGACAGACACGAGCACCAAATGCTGAAACACAGG
TTGCAGTACTCTATATGAAGAGGACTGATGTCTTTATATA
AAGATGAAGAAGTGTGAAAGTGACTCTATACAAAGAGAAC
TAAGTAAGGAAATACCTCTATTGAAAGAGAAAAACGTCAG
GTAAACTGAAGCGCATAAAGGTTTCTAGTTAAGCTCTGGG
ATCTGTATAAGACTGACAAAAGCAACCCTTTTCTCTTTTT
TTAAAGGATGAGAATATTGTTAATAGTTTGTCAGGATGTT
ACAAGCAACAAGTGTTTTGATAAAAAATAATAAATAAATA
AATATAAAATATGATTTAAATATGTGGAGAAAGGGAAGCT
GGCAGAACACAGTCAGCAATATGTTCTTAAGACCAAATGG
TAAGATTTTACTCCAGTTTTGTATTGCGTATTAAGCAGTG
TGATTCTTCCTCAACTGATATGGGGAAATATGTGTCAGTG
GTTCTTATAGGTTAAATACATTAAAATCTGATTTTCTTCA
GTGAATGTTTTTTTTGCCATCTTTTGCCAGATGTTTCCTA
TTAATTTAATCCTAAGTTGATGCCTAAGTTTCTATTTTGC
ATTTTTGTACTTTTGCTTTCAATCATCGTCTTGTCTGTGT
AAAGATTTTATGTTAATTTATTTTGTACATGCGTTTATTA
CTTTAAATGAAATAAATTATATGAGAAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations