Community Action Needed: Please respond to the NIH RFI
Transcript

rhocb-201

ID
ZDB-TSCRIPT-090929-5648
Name
rhocb-201
Previous Names
  • rhocb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022263 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022263|OTTDARG00000018368|ZDB-GENE-040718-144 rhocb|OTTDARP00000018666 rhoad-001 LG_none AL954868.6,BX323059.7 Danio rerio protein_coding KNOWN, 1027 bp
CAACACACTGCGCCAAGCAAAATCGAAACCTTCAGCGCTG
AAACTTCTGTCCGATAACAAGTAATGGCAGCTATCCGTAA
GAAGCTGGTGATTGTGGGAGATGGAGCCTGTGGAAAGACC
TGTTTGCTGATTGTGTTCAGTAAAGATCAGTTCCCTGAGG
TCTACGTGCCCACAGTGTTCGAAAACTACATTGCTGACAT
AGAAGTGGACAGCAAACAGGTGGAGTTGGCTTTATGGGAC
ACAGCTGGCCAGGAAGACTATGATCGGTTGAGGCCATTGT
CTTATCCAGACACAGATGTTATCCTGATGTGTTTCTCTGT
AGACAGTCCAGATAGTTTAGAGAATATTCCAGAGAAATGG
ACGCCAGAGGTAAAACATTTCTGTCCCAACGTTCCCATCA
TCCTCGTGGGGAATAAAAAGGACTTAAGAAATGATGAACA
CACACGCAGAGAGTTGATCAAGATGAAACAGGAACCTGTC
AAACCAGAGGAGGGCCGTGACATGGCCAACAGAATCAGTG
CATTTGGATACCTGGAGTGTTCTGCAAAAACTAAGGATGG
AGTTCGAGAGGTATTTGAAATGGCCACCAGGGCGGCGCTG
CAAGTCCGTAAGCGCAAGAAGAGAAGCGGCTGCCTGCTGT
TATGAGCGACACACTGAAACACATGCGCGCACACACACAC
ACGTCTCCTTGTACCTTTCAGCAGCTGATCCCAAGAGACA
CCTTTAATACCTACCACAACCCAGGTGTGGATGACAGAAA
AATATTTATAAAGAATCTGCACCATGTGTGTGTGCGTCAG
TAACCAATACCTCTCCATTCTGCCATCTTTCTCTTTACTT
TTCTTTTCGCCAATATACTTTTCTTCTCTGGACTGACTGA
TTAATTTTGTATATGTACATAAATCCTCTCTGTCTCTTTT
GATTCTGGTTTACAGTTATTCTATGCCTCTGTATATGATG
CTCGGTGATTTAAGTTTAAAAAACAAAACAAAAGCAAATA
TACATTTATCATTCATTTAAACTGCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations