Transcript

nkx2.2b-201

ID
ZDB-TSCRIPT-090929-5440
Name
nkx2.2b-201
Previous Names
  • nkx2.2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021955 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021955|OTTDARG00000018161|ZDB-GENE-050217-3 nkx2.2b|OTTDARP00000018455 nkx2.2b-001 LG_none BX663521.11,CT573061.8 Danio rerio protein_coding KNOWN, 1634 bp
GTCGTGTCACCTCATCCCACTCATGCATTTCTGATCTTCC
GCTGATTGAAGCTCAACTCACTATATTTCACACCCGCAGA
AGCGCTCGAGCACTTGACTCCACAGATCCACCCTTAATCG
CCAAGGCCGCTTTTTTCCTGGAGCTCCAACACTTATCCAC
GACCTTAAATGGACCAGACTAATGGATTGGTTCGGTCAAG
CACTGTAACATCTGAAAAGCATCTGTGATCCGTGTGTGCG
CTGTCCAATAGGAAGGATATTTATTATTTATAACTTCACC
GAGAGACCTTCACTGTCGCAGTCCTACTGGTTTGGAAAAT
GTCCCTAAAGAATTCAAAGTCGGGTTTCACTGTACGTGAT
ATTTTAGACCTCCCGGACACCAACGACGAAGGATCTGTGA
GTGAAGACACTGAAGATGAGCAGGATGAAGGACTCAATGC
AAATCAGAAAAAACAGCACGACTCCTCTAGAGACGCGCTC
TGGCTCGGATCTTCGTGCGGACACAAATATCCAGTGCCGT
CAGCATCTCCAGAGGAGTTGAATCCAGAACTGTCCGCGGA
TGAGTCCGTTGACCGGGAAAGCTCGGAGGACTCCGGGAAA
AAGCGCAAACGAAGAATCCTGTTTTCAAAGACTCAAACCT
TTGAGTTAGAGCGACGCTTCAGGCAACAGAGATACTTGTC
CGCGCCTGAGCGAGAGCATCTAGCCAAGCTTTTACACTTG
ACTCCAACGCAGGTGAAGATATGGTTCCAGAACCATCGGT
ACAAAGTGAAAAGGGCGCGGGCTGAGAAGGGATTGGACCC
GTATCTGCTCTCCCCGCGCAGGGTGTCAATTCCCGTTCTG
GTGAGGGACGGAAGACCGTGTCATCTTCTCGGCCCTCAGG
ACATAACTGCCTCGATTCCTCCGGCAACTGCGCCGTTTAC
TGCCTTTAATATGAAGCCGTTTCCGCAGATTCACCACAGT
CATAACAACATCGTGACACATCTGACATCATCTGTCAATC
ATCTGGGCCACATGCAGCCATGGTCCTGGTGAAGAGAACA
CGTACATCGCGGAGACGTCTTGATTTGATGTTTGCGCTTA
CATGTATTTAGAGCATCTGTGAAATGCCTATTAGACGTCA
ATCTGAGACGTTAAATATAGACGTACGTGTTTAAGGTATT
TACAACTTACAATTACAAGCAGAACTTTTATGACATTACA
ATGACGTCACAATTGGGAGCAGATCTTTTTATGACGTTTA
TCAGACCTCTTAACACAGCAGATGTTTTCCAGACCAAATA
CTTCTTGAAGACGAACGTGTGCTATTTGGGCACGGAGCGC
TTTTGTTTTCGTCTTTACTGCAAGGTGGATTCTTTATGTC
TATGTTTTCAATTGTCTAATATTGTATTTCCCATCTGTTA
GTTGCAATTTAATAAAAAAACAAAAAAAACATACACTTGG
GACATCATGTAGATATATTTATGCTGGAGAGTATCTTTTT
GTATTGATTTCATTTAAGTTCAGTTCTCTGATATGTTCCT
TTTAGTTGCAATTAGAAAAGACTGGGGAAAGTAGATTATA
GTATGTTGTTTTTTATTTTATTTGAATAGCTGGAATTATT
CAGACTAACCTGTAATAAAAATTGTGAATGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations