Transcript

il10ra-201

ID
ZDB-TSCRIPT-090929-5364
Name
il10ra-201
Previous Names
  • crfb7-001
  • il10ra-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021799 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021799|OTTDARG00000018038|ZDB-GENE-070905-4 il10ra|OTTDARP00000018330 crfb7-001 LG_ BX901957.4 Danio rerio protein_coding KNOWN, 3764 bp
ATTCACAGCGCAAATACATAGAGAGCCAGTCAACCACTCA
AAGCCACATTTAGAAGAGAGAGAAAACGAGAAAGAGACAT
GCAGATCAGACTGCAAAGTAGATGATCATTGAGCTGTTGT
AACTGCTTGGGTGCTACAGATGTTTAGAGCGTTAAACTGA
GTTTGAGCATTTATGTGGAAAGAGAACTATGAATTGTTGT
TGGATATGATGCTGAACTGACATTAAACATGGATTGGACC
TTGTGGATTTGTTTTCTAGTCTGCTGTACCCCAGGATTGA
TAGCAGGTGAGCAGAAGAAATTAAATCTGACGTTCGACAT
ATGGGAGGGAAATGTAACTGTGCTGTGGGATCCCCCCAAT
GAAGCCCCCGTACCTGCCTTTTATCAAGTAAAACTAGCAC
TAGACACTGGTCCTCATGCTAAATGGAACATTGTGGAAGA
ATGTGACATGATTACAGAAACTAAATGTAATCTTGGAAAC
TTTATATTCAAACCTACAATGAAAGTAAAAATTGAACTGA
TAAGTGGAAATAACGAATCTTCCTGGTTGGTGATAAGAAG
AATTCGTTTAGATTATATTAAGCTGTTGTCTCCAGACTTT
GACCTGTTCTCAGGGCCAAATACGGTGAAGGTTAAGATTC
ACAGAAAGCCATTTCTCAAAGAGCTTTTTCCATATGGACT
AAGTTACTCTGCCATTCTGTATCCAAGAGGACAGGAGAGT
AAGGCTAAAACATTGAGTGATGATGATGATGAAGATGGTG
AAGTGGAGTTTACTGATTTATCATATTGGCAAGCGTATTG
TGTTCGTGTGAGATTGGCGATCACATCTATTGCAGTGAGC
AACACCTCATTGCCACGCTGCATACATCCACCAACAGATT
TGTCAGTGGTGATCTCCATCGGAGTAATTGGTGTAGTCGG
AGTCATAACCTTATTCATGTTATTTGTCTGTTTCTTCCTG
AGGCGTCCTGGTAAAATGCCCGCTGTTCTGAAATTGGCTG
TGAATGGCTGGCTCCCAATGAATGTAGGACAAACCGAGGT
GGAATCGGTCACTCAGAAGGGATGGCTACTGAACAGCAAC
AAAATCGCAGAAAAGACCAAAGCATTCGATGAAATAGAGG
AGCTTTCTGAGGATGAAAAAGAGAGAAGGGAAAGCACTGA
CAGCGGCGTGAGCATCGGCCAGCAGGACTCGATCAAAAAC
AGACCCCAAAGAGAGGAGGACAGCGGCTGTGGAAGTCTCA
CAGGAACCGAGGACAGCCTTAGCAGTGGAAGAAGAAGCCT
TGAGGAGCTTCCTTTCCTGGATGGAGGAGGAAACAGCAGT
AGTGTTGAAGGAACAAGAGAGGACAGTGGATTGGGAATTC
AAACCCAAGATATTTCTGACAAACCCAAGCCTATGCATGA
TGATCTCTTATCTGAGATTGTAGTAATTGGGGATGGGTAT
CGTAGTCAGAGTCCTTCAGCTGAGGCTGAAACCGAAACAA
CCATTCAATGTGATGAAGACGCTAATATGGTTAGTCGCAC
CAATGGCTATCGATCTGGTCAAGTCACATGCTTGTGTTCT
GACTCCGAAACTTGCATGTGGTGCAAAACCAGGAAGCACC
TTACAGACTGTGATTCATTTTCTCACAAACAAACTGTTAA
TGACAATGATAGATCAAGCTATTTGAAAAAATCTCCTTTA
GAGACTGTGAATATGTTTGGACTGGATGATCTATCCTGCC
ATTCAGACAAAACAGAGGAGTCGTCACTTTTCATTACATG
TCCACTACTTTTAAAAGAGCCTTACAAGCTGGACACTTTG
CCTCTTACATTAGGAGACGTAGAGCTGACATTTACGTGAG
GCTTTTTCAGGTTGAACTAGGCTATTATTATGCATTTGTG
CTAACAGATATTTATTTAGAATGGTGGCAGAGACGTGCTA
TATTTGCTAGGCCCTCAAATGAAGAACCAGCTTTTGTCAC
TTCCTTCATGCGTCAGGCCAGCGTTTTTGGTTAAATGCTG
AGAAAAGACGAGATATGAAGAGTGTGAAATCATCAGGATA
TGATGACGCTCGTAGTAATTCTGGTTGACAGATTGCAATC
CAATTCTGAATTGTGTTACAGACTTGTATTGATCATTTGC
AAACTTGCACATGTATTGTAGATTTTGACTGTACATGTTA
TATATGTACTGACATTTTTTTATATGCTAAATTTCATTGC
TGAATGTAATGAAATGTGATATTAATATGAATAATAATGG
CATCGAAGTCAATATGCTGTGTTTTTGTCAATTATTTGAT
ATAATCAAATCAACTATAATTATAATTTATACCAACAGAA
TTTGTGGGTTATTTAATTATTTTTTTAAATCTTTAAATGT
TTAGGGGTAGAACAAAACTCAAAATTTACAGTTAGGAGTG
TACTATATTATTTTGATTAGTGCATAAAAGGTGGTGCGGA
ACAATTGAAAACTTAAATATCAATTTGTTTACTTGCATTA
CATCCATTACTCAAAGGACATTACATATATTGCATTAATT
ACTCACCTATTTTACCCAAGATGTAAGAAAAGACTTTTGT
CTGAACAATGTATCTGTAAAGTTTCAGCTCAAAATACCAA
TCAGTTTATTCATCATATAATGTAGAATCTGCCCATTTTA
GTGGCTGAGGACAATGTAGCTGTTTTTGTAGCCTGTGGCT
ACAAATCCAAATGAGCTCCCTCTCCCCGCTCACCACTCTG
ATGTGCACGTCTGCTTCTCGTGTGTTACGTCAGATAAACA
GCAGTCAGTGATAGAGACAGACACAGATGACGCTGAAATG
TCACTAGTCAAAAATAGTTAGAAAGTTTATTTGATGTATA
TGTGGTGGACTATTCAAGCCTTTCTGAAATGACACACACA
AATGCAGTTTGCAGTACACACACACTTACACACATATGTA
AGTTTACTGGGACCATGTGGCTGTGGTGATTGTAGCGGTT
AAGAATTACATAGCTATTGTACTCTCTTTATGAATAGGGT
CTGTCTGTGGACTGCAACACATGAAGTAGTAGTGTAGTAG
CATGAAGGGGCTTAACTTGAAGTTAAGGAGACTCACATGT
CAAAACTCTGTTGTCAGCAAGATGGTGCTAGACATCATTA
ACATCCACACCCACTCCACACCTAAATCCAACCGTCACAG
TTAAAATCTATACCTCCCACCCCCAACCATGATAGTTAAT
TAACATCTACACCTCCCCTAAACCTAAACCCAGCCATCAT
CATTATAAATGATCACAACTTCTCCAAACCTAAACCTAGC
CATCACAGTTATTGTCTACATCTTCCCCAAACCTAAACCT
AACTATCCCAGTTATTAACGTACCACCGCGAGTTGCGGAG
GCTTTTATACTTGACCTGCTCACCATTGTACTGTTATTTG
CAACCACAGGGGTCTTGACAAACTGATGAAGAAGTCAGCA
AGTTGCATGGTGGAATTGCTAGATGACTGAATATTATACT
ATTTCAAATGATTAGGTTATGGATAAATTTGGAGAAAACT
CATGAAAACATTTGGTGAAATTGTTCTCTGTTAAGTAGTT
CTGCCATCTTGCCAACAACACCTCATCGTGACATCTCGCA
TGGTTCAGTGGGATCTCGATAACTGCAAGTTATGTCTCTC
TAACTTATTGAAAGTTATGCCCCTTCATCTTAAGCCCCCC
TCTTGCAGTCGGCAGAGAGATACAATTGCTGTTTATTACA
AACTATTTATTTTAAACCTATAAAATAAATTATTGGGGTG
CAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations