ZFIN ID: ZDB-TSCRIPT-090929-528
Transcript Name: si:dkey-177p2.6-201
Previous Name: si:dkey-177p2.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005692 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005692|OTTDARG00000005252|ZDB-GENE-030131-5926 si:dkey-177p2.6|OTTDARP00000005081 DKEY-177P2.6-001 LG_ BX248515.4 Danio rerio protein_coding NOVEL, 4764 bp
TGACGACCGTCAATCAGCTGAGATCTTTCCCGTTCATTCT
ACAGTGTAGCGACAGTTCAGCTCGTGTCGGCGGTTGAGAC
GCGATCCGTCGCGTAGTTTTGCGTAAAATAATGTTAAGAC
TTTGGACTAGAAGCTCAACACGGAGTTCAGTGACCGGTTT
AAACAATCGCATGTCTTATCAGTCAAGAGAATGTAGCCGT
CATTCGAGGATCCTGAGTAAATTAATTTCGTAGATGCATA
CAGAGAGAGACCGTACTTTACCAAGTACGAACTGGCTAAC
TGGCTAATTCATTGCGCATCTCTGCGAGCTTAGCCGCGGA
AGCTAGCGGCGAGCGCTCACGTTTTGCCAGAGTAGTTGGT
AATAATAAACGCTAAACAACAAAGCAACTGGTAGAGCCAA
ACATAATGGTATGGGTCAAAGGGATATCACAGCGTTCGAG
GCGTCCATGAAAAGAAAAAAAGGAATCCCCACCGTCTCTA
TGTGTCGACTGGATGTGGAGTCCGCTGTTGTGAAGAAGGA
AGTTGAGCCCGGCGGACGAGATGGTGCTCTTTCCTCGTCA
AGATATCTGTTGGGCCGGGGGGTAAAGCGTAAGCTGAGCA
CATGTGAAGACCCAGCCCAGGACTTGCCATATCCTCAGCA
GAGGCAGCTGGTGCTGGACCTGTGTCTAGACAAACTACAA
AGCTGCCAGCGGCGAGCGGAACCCAGCCTGCACCGTTCGG
TCCTCCTGGCCAACACTCTCCGCCAGATTCAGCAGGAGAT
GAGACAGGAGGGGGAAACCTGTTTGCCACCAGCCGTACTC
GGGCCCTCTCTTCCTCACATCCAGACCCCACGCCACGTCC
CAGAGCTGCCACCCGTGCCCTTAGACTGTCCTGCACCTCT
AACCGGTGCACTGTCCCCTTCATTTCCCCTTATGACAGCT
GATGAAGAGGAGATCCAGTTGGGTGGCACTGAAAATGAGA
CTCTTCTGCCATCCCTCGCTGGTGAAGACAACACAAAGTC
GTCAGATTTGCTTTTTGGCTCATTTGAGATTACAAACTCC
ACCAGCTACTTAACAGACTTGGCATTAGATGACATCTTTG
AGGACATCGACACGTCCATGTATGACTCCTCTGACATTTC
TGTTCTCGCGGTTCCTGCACAGAGAAGCGGCGGGGTAGAC
GATGGCCTCAAGAGCCTTTCCAGCTGCAGCTCCAACAGCA
GCTTACAGCTCTGTCTCACAGACCTCAACGACCTGGACCA
CATCATGGAGATCTTGGTGCGCTCCTGAGCTCCAGCTCGC
ACCACAGTGTCCTCGTTCAGCCATCTTGATGTTTTCTATG
GGAAATGAGTAATACGATGTGTTTTTCTTTTTTAAAAAAC
AAATATTTTATCTATTTTTATACAAAGGACTGATATATTT
ATATAAATATATATAAGAAATGGAAAAACTGCCTGACACA
CTCTCACTGTAGGATAAATGCACATTTTTAAGACTCTTCA
GATGGTCAAGCTGACGCTGCCATCCTTCATATTTAAGCAA
ATCAAGATATGAATATGCAGGGACTTCGGAATCAAAAACA
AAGTATTACCATTGACACTTATTTATAATGGACTCAGATG
TATTTAAAAGGAGGATGGCATTGAAGGAAAGTGGACAGGG
ATGGACACTTCGTAGCTTTTGATGAGCTAAATGACTTTTT
TTGGTGATCTCCACTGTATTCTGAAGCATTACATTTACTG
TCAGTAATTACGATTATCAGATCATGTCATGCACATGCAG
CACTCACACTACCTCTCAAGATACCAAGAGCTCTTTCTCT
ATACAAAGACTGTCATTGTTACGAGTATATTGTAATGGTT
TCTCTCCAGTAACTTTCAAAAAACAAAACAAAAAAAAACG
CTGATTGTTTTATAAACGGGAAAGCCTCTCCTCAAGTGGT
AGAACTCAGTCCAAAGCTATAGCTGTAGAAGAAAGGCTTT
TTTCTCGATCTTTCTATTTAAAAACGTTCTTTCCGCAACA
TTTCTGATTCGTTTGGTTTCAGAATGATCTGTCGCTTGTG
TAAAAAAAAAAAAAAAAAAAGTGATATATTTTTTCGAAAC
GCTTGGAATTAAATGCTATTTCTACTTCTCACGTACATGA
TTGTCAGACACACAGCCACCGTCGAATCCCTCGTATGAAC
ATAGTGCCTACAATGGAGAATGAAGACTGCCGACGATGAA
CTGCACACTGTGGACCTGCACATAGACTTGCCTGGGTTTC
CTGCTCTACGCCCCACATGGGTCGTTTGCCGCTTTTCGAG
CACTCAGCACGATTCTCTGTCCTCTAAAAAAAGCCATTAC
CCAAATGTGGGTCCACATCTTCTTTCTACTGTCCTTCATT
TTGATCTACACTGCAAAATGCTGTTGTTGGATGTCTATGG
ATGCCTCTTGTACTGTGGTCTCCAAGACCACAGTTTATTT
TGAATGTCCAAGCTTGCGTCTCACCTGCTTACTTTTCATG
AGTTTAAGGCCTGTAATAACTTGGGTTGTTAGACACTGCT
GAAACACAAAATGCTAAGAGTATTCATTTTTGAGCTGTAT
TGAACATCAAGTTGCTGCAATTGTATTCGTAAAGAACCAC
GAGCTGCGTTCTGCATGAAGACAGAGCAGAGACAAGGGGG
AGGGGAAGAACTAGAGAGCGAGATTAAGGGGGGAGTTAAA
GCAAACAGCTCCTGTCACGTGGAGAGCCCTGCTAGTGCTG
AACATTACATTGAGAGTTTGACAACAGCTGGTGTGTGTAC
GCTCGCATTGGTGCACTCTCAACAAGCCCCGCCCTCAGCG
AGGCCCAAGGGGCTCCGTGCTCCTCCCGACCAATCGTTTT
GATTCAAGGGAGGAGCTTTGCTCTCTGCCTGCTTCATGTT
GAATAGAATAACAAGTGGAAGCTGTTTGCTCATGGTGGAG
TGTCCTAAGACCAGGCATATCCAAACTCTGTCCTGGAGGG
CCGGTGTCCTGCAGAGTTTAGTTCCAACCCCAATCAGACA
CGCCTGAACTAGCTAATCAAGCTGTTTTTAGGTTTACTAG
AAACTTCCAGGAAGGAGTGTTGAATGAATTTAGAGCTAAA
CTATGTAGGATGCTGGCCCTCCAGGACCGAGTTTGGACAC
CCCTGCTTTAGACAGACGTTTACTGACTTGATAGTCTGAA
TTTGAGTTCATTTTTAGACATTCCAACTGAATAACAATGA
GATATATATTTAATTATAATTTATGTATAATTTAATATAT
GATTTTACATTAAAATACTAATTACAAAGTTCTAAGGGGG
CTGTAGGGAAGGGCTTTTTGTTATTTGGTAGAAACTGACT
TGCTCGTTCCCCTTTTAACTCAGGCTCTCAGATGCCCCGC
CCCGCCTTCTTCCCCTCACAAGACACAGAAAACCAGACTC
TTGTGAAGTTTACACTCAGATTTTAGGAAAACATGCTTGC
GAAACCAGAGAAAGTAAAGGGTGAGACCCTCGGCGTTCCA
ACAGCAGCCGGCTTTTAATGCTGAGAGCTGTGGATCTGAT
GAGTGTGTAGCTTTTTTAAGCTTTGTAAGCTTGATCAGTT
TGTTTCTTTTGCTTTTTATTTGTGTTGTTTGTGTATATAT
ATATATATTTGTATTTATACTTTTTGTTGTGTTTGGATGT
TTTTTTTTCTTTGTTGTTGTTGACTGAAGATCATGAGATA
ATATATTGCTTTTATTTAAGAGTGAAATATGATCTGTAGA
CCTTGGTCTTCAGGAGGGTGTTATTTGTTTTTTTTAAGTG
TGATTTGTACTTCACCTCCTCCTCTTCTTCTTAGTAATAA
TGTGTACATAGATGATGCAGAATTATCAAAAGATGTTTTA
TCATTGAAATTATTTGTAAAGGTTTTAATCTGTGCTGTTT
ATGAACCGAATGGGATCTTCTTCATGGTGTGTTCACTTCT
CTTTGGACCAGGCAGTAATTTAGGCAGCTTTTTGTTTTGT
TAAAGAGGTTGAATACATCAAGGGGTTTTTGCAATTCTCG
TCCTCTTTTAAATGTAATGTCTCCTGCTGCTTGATTCTCT
TTTTGTTCCACGATAATCCACCCCAAGATTTTTTTAAACT
AATGTTCATTATGATTCAGCCTGTGCATGGGTTGTAGTAA
TGCACAGAGCAGCAATGAAAAGTGGTTTACATTTACATTG
TAAACTTGTGAACAACTTTACTCCAATAACGTACGGTATG
TTTGATGTACCGGTTGCACAGAGAATAGCGTAAGCAGCAC
GGGTTTTATTCTCATGGTCCTCAAATTTGCTTGGTTGTAC
GGCACAAAATAGCAAGCTTTAAACATCTCTTCATCTTGTT
AATTTGGCAATTTTTAAGCAAATTTTATTTTAATTATCCT
GATGAAATTGTAATATCGGAAACCTCAATGTCACTTTCGT
CCCAAGTGCAATATGAAAATATGAACATAAAGCGCTGTCT
TGCCTATTGCAAATGACACTATGTAGTGAGCCTATATAAC
TTTGAATGAGTACATGGCTAGATGTTTGTTTTGCTATTAT
TGACCTTTCCTTCTCCCAGAAACTGTTCCTGTTGCTCTGT
TTTTGACCAGAGATTCGATGAGGTCTGTAAATAATAAAGC
ATTTTCTTTTGCAGTCATATTCTATGCAATACATTGTAGC
AGGTCAGTATGTCAAATAAAAGAAAAATGGAAATAGAAAG
GATTCCTGTGTTTATTTACTATCTAAAGCAAGTCAAGCTT
ACGTTTATGGTAAAAAGAAGGACGGACTGTAATGGAGAAG
GCAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-177p2.6-201 Contained in:
[BAC] DKEY-177P2 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000005692 (1),  Ensembl_Trans:ENSDART00000062066 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC124229 (1) 1772 nt
GenBank:CK126385 (1) 755 nt
GenBank:CD594028 (1) 650 nt
GenBank:CD596808 (1) 650 nt
GenBank:BI533561 (1) 591 nt
GenBank:AL922437 (1) 416 nt
CITATIONS (2)