Transcript

c2cd2l-202

ID
ZDB-TSCRIPT-090929-5236
Name
c2cd2l-202
Previous Names
  • c2cd2l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021590 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021590|OTTDARG00000017885|ZDB-GENE-041019-1 c2cd2l|OTTDARP00000018171 DKEY-252H13.4-001 LG_none BX294169.10,BX294376.10 Danio rerio protein_coding NOVEL, 2493 bp
TCTGGCTCAACGTTGACAGCTAGATTTCCACAACCTCATA
CCGTCCAACACCGCCGGTGGGAGGAAGACACATTTTCTCC
TGCGTGGACTGCACTGGTCATTGTAAATGTGTGATTTTAT
GTCGCACGCTAAAGACTGAAGAGACGGAGGCCATGTACCG
ATCAGCTCAGGTTTGATCGTGGAAGATGCTCGGACCTGAA
GGCTGGTGCTGGAATTACGAAGACATGATGTAGCCATTGA
ACCACTCTTCTGTAGCTAGTCAGCGCGCGAACACGGCGTT
TCTCATCTGATCGAGTTCCAACCTTCGTGAGTCAATATTT
TCACCCCTTCATAAAAATGGGACTCAAGTGATCAATGCCT
TGGGAGATGACGACTTTCCAGGACGTGAGCTGGCTGGTTC
AGGTGGCACTTTTCTGTGCCTCGCTGCTGGTCGTACTAGC
CTGGCTCGTTCAGTTCTCACTGGCGTTAGTTCGCCCTAGA
TGGTGCAGCAAGCTGCAGGGCAAGAGGGAGACCCCGTGGC
AGCTGCCCTTGAGTCTCACCCATCAAACACTGACCGGAGG
TGTGTGGGGATCTCTCCTGAGGCTGAGGCTGGGACGAGAC
GGGGCAGGAAGTGACACTGAAGCTGGCGTCAAGGGCCTTT
TGTCCTCGCTCTTTGCCTTCAGGTCATTCAGGGAGCACTG
GCAGAGAGCATGGGTGCGGGCACTCAACGAACAAGCCTGC
AGACAAGGGAGCTCCATTCAAATCACCTTTGATGACAGCC
TTCAACTACCAACTTCTGCGTCCATTGACCGTGTGACTTG
CACTGACCAATCAGTACGCAGCATGGTCCTGCAGTGCAAT
TGTTCGGTCGACACCGTGTCATTCCCTGTGACTGTCACTC
AGCAGTCACCTGCCACCGTTTCTATGGATACCTACCAGAT
CACGATGGATCCCATGCAGGCCCAGTTGCAGGTCTGTCTT
GAGGAAGTGGAGGAAGAGGGTCTCTTGGTGTCCTGGACTT
TTTCCAAGCAACCTCATCTCTCTTTAACCGTAACATCACG
CCAAAGAGCCCAGAAGGAGGGCTCTGATGTGGAGGTGGAC
AGCGATATGATTGCTGCTCTGGTGGAGGACACGCTGTACA
CAACGCACCCTGCCATGATCCTCAACCTGAGAGCCTGTGT
ATCAAGCCCTGCGTTTCCCAGGGAAAAGCAGATTGGTGGT
CTTAACTCTCCATCTCAGAGCACACCAGGCAGGCGAATAC
TGGTGCACCAACTCAGAGCAAGCAATGTCAAAAAAGGATG
TCAGTCTCATGTAGGAGAGCTCTGTTGCGTGCTGAGCTTG
GACACTCCTTCCATTGAACGGAGAACCGGCTTCCTCACTC
CTTCCCCCAGTTCTGGAGCAGCCCTGCACTGGACTGACGA
CTTCACACTGGATGTAGGACCAGACACCAAAGAACTCAAA
GTGAGACTCGTGGAGAAAAACAGCAAAGGGGAACAGTTTC
TGCCTGGTCATGCTTCTTTGGCATTGGATCTCTCTAAGAG
AATTCCTAATGGACAACATAAACTGTCCATTGCTCCAGGT
CACGGTTTGGCTCCTACCGCTATCGTATCATTAGAGCTGG
CGTATGTGGAGTCCGGTGATCTTCGCGTATGTCAGAACGC
CACACCTCTGCGTTCCTCAGTCACTCCCTCTAAAAAGGTG
GACGTGGACCGCACCATCATGCCCGACGGCACCATTGTCA
CCACTGTCACTACTATACAGTCACGACTAAAACTGGACCG
AAAACTAGGCGAATCTCCGTCTAGATCTCCCTCAAAGGTG
GAGGTGACTGAAAAGCCTCCCACCGTGCTCACCAACAGCT
TACAGAGCACCAGTGGCAGTGGCACCCCCAGCAAAGGCAC
CCTTCCCAATGGGCTGGATCCCGTAGCAGAAACAGCCATT
CGACAGCTGACAGAGTCTGCTAGTAAGGTACCCAAGAAGA
CGCCAACCAAACGCAGCACTCTCATCATATCTGGGGTGTC
GAAGGTGCCCATTACTGAGGATGACTCAGCCTTATCAGTG
GGCTACGCTGCAGCCATGGACGCAGCCCTACAGGGGGCTC
AATCTCCCAGTGGAGCCCCGAACCACCACGGAGCATCCAC
ACACCAGGAGCCAGACGAGACCACGCCGTCTGACGCCTCA
GAGCGACCTTCAGTGGATGACGCGGAGTCGGAGACGGGAT
CAACCGGCGCACTGGAGACACGCAGCCTCAAAGACCACAA
AGTGGGCTTCCTCCGCAGTGGCACCAAGCTGCTTTTCCGG
AGGAAAAACCGAGAGAAAGACGCCAGTTTCAGTCAGTCTC
ACGAGGACATCTCTAACCTGGGCAATGACTCCTCCACGGC
CTCCTGCTCCTCCACCAGCCGTAAGAAATCTGGAAGTTTC
TCTCGTCGCCTCATCAAACGCTTTTCCTTTCGCTCATCCA
AGACAAAGGGCAAAAGTACAGCCAACGGCGGGTCCAACAC
TACAGACAACTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations