Transcript

dscamb-202

ID
ZDB-TSCRIPT-090929-5106
Name
dscamb-202
Previous Names
  • dscamb-001
  • si:ch211-69g13.1-001
  • wu:fm10g02-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021424 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021424|OTTDARG00000017778|ZDB-GENE-031118-67 dscamb|OTTDARP00000018042 dscamb-001 LG_ CR388412.9 Danio rerio protein_coding NOVEL, 6992 bp
GATCAAGATATCTTATTACATCCACGGGGGCCTTGTATAT
TCTGGATGTGCAGTCGGAGGATGCGGTGAATATTTATCGC
TGTACCACGCGGCACCGATACACAGGGGAGACCAGACAGA
GTAACAGTGCCCGACTGCTTTTATCAGAACCTGTGGATTC
TGCTCCGGTGATTCTGGATGGGTTTGAACGGAAGGAGGTT
ATGGTGGGTCATCGGGTGGAGCTCCCATGTAAAGCATCTG
GTCACCCTCCGCCCAGGTATCGCTGGCTGAGAGACAACAG
TCCATTGGAATCAGATAGCCGGTACCATCAGAGTGTATCA
GGCCTCCTCATCGAGGCCACACGACCCAGCGATGCAGGCA
GTTATGTGTGTGAGGTGTGGAACAGCTTCGGAAATGCCAA
AGTGGTCGGACGGCTGGTTGTCAAACAGCCTCTGAAAGCA
GTGGTGAGCCCACGGAAGGTGAGGGGCAGCGTGGGTAGCC
AAGTGTCTCTGTTCTGTAGTGTGACTGGCTCAGACGAGTT
TGACATCACCTGGTACAGGAATGCGGAGAAGATCTATCAG
GGTATAAATGTACGAATCACGGGCATTAACAACGAGAACC
TGGTGATGGAGGGAATGGCCAAGAGCGATGGAGGAGCGTA
TCAGTGCTTTGCTCGAAATGGAAAGATGTCCACCCAAGAC
TTAGTTCAGGTCGTCTTGGAAGATGGGACACCAAAGATCC
TCTCTGCCTTCAGCGAGAAGGTTGTGAGCCCGAATGAGCC
CATCTCGCTGGTGTGTCACGTGAAAGGAACCCCCCTCCCC
ACCGTCACCTGGACCCTGGACGACGACCCCGTCATCAAAG
ACAGCAACCACCGCATGGACCGCATCATCACCACAGAAGG
CCACGTGCTCAGCTACCTGAATGTTTCTCACACGCAGGTC
AGCGATGGGGGGGTCTACCGCTGCACCTGCAACAACTCGG
CCGGATCGGTCTCCTATCAGGCTCGAATAAACGTAAGAGG
TCCTGCCAGTATTCGACCAATGAAAAATGTCACTGCCATC
GCTGGGAGGGACACGTACATACACTGTCGCATCATTGGTT
ACCCGTACTACTCTATTAAGTGGTATAAGGATTCCAATCT
GCTCCCATTCAACCATCGCCAACGTGCCTTCGAGAACAAC
GGCACACTCAAGCTGTCCAATGTGCAAAACTCAGACGAGG
GAGAGTATACATGCTACGTGTTGGTGGATCCAGAGAAACA
AATTCACAGGAGTGTCCATGTGACAGTAAAAGTGCCCCCT
CTTATCCAACACTCCGACTCTCAGAGTGCTTCCATTGGTC
AGCGTGTCTTCATCCCATGTGTGGTCATATCCGGCGACCT
GCCCATGTCTATAACCTGGCACAAAGATGGACGACCAATC
AACGCCAGCCTGGGTGTCACCATCGACAACATAGACTTCA
CCAGCTCACTGCGCATTTCAAACTTGTCGGAAATTCATAA
TGGCAGTTACACCTGCATCGCCCGGAATGAAGCTGCAGCC
GTCGAACATAGCATACAGCTCATCGTTAAAGTTCCACCAC
ATTTTGAGGTTCAGCCAAAAGACCAGGACGGCATATATGG
GAAATCAGTTACCTTGAATTGTTCGGCAAAGGGAAATCCA
ATCCCCACTATAGTGTGGAACCACTCAAAAGGTGCTGGCG
TTCCTCAGTTCCAGCCCATTGCCTTGAATTCTGGCTCCCG
CGTCCAGCTCCTGGAGAACGGCTCTCTGCTCATAAAACAC
GTCCTGGAGGAAGATGCTGGATTTTATCTGTGCAAGGTCA
GCAATGACGTGGGAGCCGATATCAGCAAGAGCATGTACCT
CACCGTTAAAATTCCTGCCATGATCACATCTTACCCCAAC
ACCACACGGGCAGAACAGGGTCACATGACTGAGATGAGCT
GCACTGCTCACGGTGAAAAGCCCATCAAGGTTCGCTGGGA
GAAGGAATCTCATATCATCAACCCAGACATGAGCCGTTAT
GTGGTTACTGTGAAGGAAGTGGGGGATGAGGTCATATCCA
CCCTGCAGATCTTACACACTGTCAGAGAGGATTCTGGCTT
TTTCTCTTGCATCGCCATTAACTCTTATGGTGAAGATAAA
GGAATCATTCAGCTCATAGTTCAAGATCGTCCTGACCCTC
CTGAGGTTGAGATCAGAGAAGTAAAGGACCGGACCATCGC
ACTTCGCTGGACCATGGGCTTTGATGGCAACAGCCCCATT
ACAGGATACGACATCAACTATAAAAACAAATCAGCTTCCT
GGGCCTCATCACAAATGACCAAAGACGTCTCCCCTCAGCT
GAATCAGGCCACCATCATTGAGCTTCACCCTGCTTCCACC
TACAACATCCGCATGTTCGCCAAAAACCAGATCGGAGAAA
GCAGACCGAGCAACGAGCTGACCATCACCACTGACGAAGC
ACCACCCGACGGAGCTCCTCAAGACGTGCAGCTGGAAGCG
ATCTCATCCCAGGGCATCAAAGTCACATGGAAGCCCCCCC
ACAAACACTTGCAAAATGGCTTGATCCGAAGCTACCAAGT
GTGCTATCGGGAGTTCGGGACAGGAGGCAGCCCACAATAC
AACACCATCAACGTCGACACCACGGGAGACATTGAAACCC
TCACTCTTGATAACCTGAAGAAGTACACGCAGTATGAGGT
GCGGGTGCAAGCAGCCAATCGAGCAGGAATGGGGCCAACC
TCAGAGGAAATCACCATCACCACGCTAGAGGATGTTCCCA
GTCGCCCACCTGAAAACGTTGTGACCACAGCTACGACCCC
TGAGACCATCTCTCTGTCATGGTCTGCACTGCCCAAAGAA
GCCCTCAACGGCATGCTGCTCGGATACCGTGTCATCTTCT
GGGCCAACCTACCTGATGGAGAGCTGGGAGAGATCAGGAA
CATCACTACCACCAAGCCTTCGCTGGAGTTGGAGCGGCTG
GAAAAATACACCAACTACAGTATCCAGGTGCTGGCCTTCA
CTCGAGCTGGAGATGGAGTTCGTAGTGAGCAGATCTACAC
ACGTACCAAAGAGGATGTTCCTGGCCCTCCGGCTGGAGTT
AAGGCTGCTGCTTCCACAAGCTCGGTGGTGTTTGTTTCCT
GGCTGCCACCACACAAGCTCAACGGGATCATCAGGAAATA
CATCGTCTTCTGTTCCAACCCTTACCCCACGGTGATTAGT
GAGTTTGAAGCCGCACCTGATGTTTATTTCCGTCGCTTGA
CCAACTTGAACCAGAATTGGCAGTACAGCATCTGGGTTGT
GGCGGTGACTGCGGCAGGTCGTGGGAATACCAGTGAAATT
ATCACCGTAGAGCCCCAAGCTAAAGCCCCTGCTCGAATCC
TGACATTCAGTGGCACTGTGACCACTCCCTGGATGAGGGA
CATTGTCCTTCCATGCAAAGCAGTCGGAGACCCCCCTCCA
ACAATCAAATGGCTGAAGGGAAATAATGGTACACCTGCTC
CAGTTTCAATCGATGGTCGTCGCAGCGCTCACAACAATGG
CAGCTTTGTTATTCGTACCGTCAAAGCAGAGGATTCTGGG
TATTACAGATGTGTTGCCAGCAACAACTGGGGTTCCGATG
AGATCATGCTAAATCTTCAGGTCCAAGGCTACATTTTACA
GTACTCAGAGGATAACAGTGAAGAATGGGGCAGTTACTCC
ATCAGCCCCAGTGAGCGCTCTTACCGTCTGGAGAATCTGA
AGTGCGGTACTTGGTACAAGTTTACTCTGACTGCACAGAA
TGCAGTAGGTCCCGGACGCATCAGTGAAATCATTGAGGCC
AAAACCCATGGAAAAGAACCACAGTTCGCCAAAGACCACG
AGCTTTTCTCAAGTATCAACTCTACCCGCGTGGAGCTCAA
CCTCATTGGTTGGAACAACGGTGGCTGTCCAATTGACTCC
TTCACACTAGAATATCGGCCGGTAGACACTACCAAGTGGA
CTATGGTAAAGCGGGATTCCCTCACCAAGAGCCACATTCT
GTACGACCTACAGGAGGCCACCTGGTATGAGCTCCAGATG
AGAGTCGGCAACAGTGCAGGAACAGCGGAGAAGAGGGTGC
TGTTCGCTACTCTGAATATGGATGGCAGCACAATTGCTCC
ATTGCCAAAGAGCGTGGACCCCAGCCAGGAGAACAGGCAG
GGAAATGAAGGACTTAAGATGATGGTCACGATCATCTGCA
TTCTGGTGGCAATCTGCATGGTCTTCATCGTTCTTCTAGT
ATTGAGGAGGAGGAGAAGAGAGCAGAGACTCAAGAGATTA
CGAGATGCTAAGAGCCTAGCGGAGATGCTAATGAGTAAAA
ATGCACGTACACCTGACACCGTGAACAAGCAGCAGCAGAC
TCTGCGGATGCACATCGATATCCCACGTGCTCAGCTACTC
ATCGAGGAGAGGGACACTATGGAGACAATCGATGACCGCT
CCACAGTGCTGTTGACGGACAATGACTTTGGAGAAACATC
TAAACAGAAGTCCTCAACCGTCACCCATACAGTGCATTAC
CAGTCTCTATCTCAGGCCACTGGACCACTAGTAGACGTGT
CTGATGCTAGACCTGGTACAAACCCCACTGCCCGCCGCAC
AGCTAAAGCAGGTCCTGCCACACGCAGTCGTTATGCCAGC
CAGTGGACCCTGAACCGGCCACATCCTCCCGTCTCCTCAC
ACACACTCACTACGGACTGGAGGTTGCCCACTCCGCGCGC
CACAGGCTCGGTGGACAAAGAGAGCGACAGCTACAGTGTC
AGTCCCTCTCAGGACACAGACCGCGCTCGCAGCAGTATGG
TGTCTACAGAAAGCGCCTCCTCCACTTATGAGGAGCTAGC
CCGTGCCTACGAACACGCCAAAATGGAGGAACAGCTGCGA
CATGCTAAGTTCACGATCACAGAATGCTTCATATCGGATA
CATCCTCTGAACAGATGACGGCCGGCACGAATGACTACAC
AGACAGCCTGACATCCAGCACGCCGTCAGAGTCGGGCATC
TGCAGATTCACAGCCTCCCCACCCAAACCACAGGACGCCA
GCCGGGTCATGAATATGGCCGTGCCTAAAGCACACAGACC
CGGCAACGACAAGCAAACAAAGAGGCAGTCTGAAAGTCCA
AAATCCAAAAACAGTAGTCAAAAGGGCTGGCAAAAAGGTC
ATAACACAATGGCAGAAACAGCAGTAGGAAAACGCTTAGT
AGGCAGTGAAACTGGCAATACTTCGCAAAGAACAGACATG
AGCAGTGTGCTTATATATCGTGGCTACCAGGAAGTACCAC
CGAGGAAGTACCCAGTCAATATTCGGGATTCGGGAAATAT
TCCCTCTGGTGGGCGGATGAATGCAGGTGAACTGGTCCAT
CTCCCCCCTTACCTACGCATGGACTTCCTTTTGAACCGGG
GAGCGGCCTCTTCAGGTCGGGAGGCCACAGGACAGACTTG
TATGGACCCACAGAAGAGCCGGATTACAAAGCGGCCGGCG
TTGCTTGCCCCCACCCCCTCCGAGACCCCCTCTTCAGCCC
TCTCTTCCTCCGGGCCCCCCAGCAGAGAGGCGGTACAGCA
GTGGCAGCCGGGAACTGCCTCTACACTGCCACAGCGCGAG
CCGGGCGACCTGGCCCAGGCCGCCAAACTCAGCAGCTCCC
AGGAATCGCTGCTAGACTCCAGAGGACACCTGAAACAAAG
CAACAACCCCTACGCAAAGTCCTACACACTTGTATAACAC
AGGACTACAGCTACGGACCACGTTGCACTGTCACGCACAC
ACAGAAACAAACAAACAAACAAACAAAAAACGTGAGGACC
TGCTGCAAAGACGAGAGCTTTTCTGATTCAGAGATGAGTC
CTGTACATACATTCTGAATTCCTAAAGAAGTGGATAGTTT
TCTTTGCATCTGTCTTTCTATCTATCTCACTCTCCCTCTC
TCTGTTTCTCTCTGTTGTTTTTTTTTTTTTACTCTTTCTT
CCTTTCTTTCGCTCACCTCTCTTCCCTCTTCTCTAAGTTG
GAATCTTTTTATTTTATTTGACGTACGTTATTTTAAATAC
CACCGTTATGAAGATTGCCAAAATTATTTATTTAAATTGA
CAGAGGAACTACTTTTGAATTTATATCAAGGATAATTCTA
TAGTCATTATTATTATTATATAAAAATAGAGAAAAAAAAA
ATTATCAAAAAATGCTTTTAAAAGGGCGGGGCGAGGTCAG
CTCTGCAGGAAGATGTTGCTTTCTTTATCCGTGACTCGAT
TGTTTTGAAGAATCCATGAGGTGCGATCAAAGATTTCCAA
GAGGAACGAGTCCAACGTGGGAGACACACGTCCACAGTTT
CCAGTCGTCTCAGAATGTCGTGCTTTCTAAGGACTGCATG
GGGACCTGCAAATAAAAAAAGATTTTTTTTTTTGTCACAC
TAAGGGATTTTATAGTGTTATAATATGTATTATGGCATTA
TATGTCATAATATATGTTACAACATACATATAAATATATA
AATATATATATATAAATATATGAATACACATGAAGAGATC
ACTTTTATTTGTGGATAATACAGGGAAGAAAAAAAAGATT
TGGTAAATAAAGTCCTTAGTCATGTTTGCACACATCTGGT
TTGATTAGAAAATTGAAACTGTTGGGTTCTCTTGTCTTTT
TTTGTGACTGCGTAACGGTAGTTTCATCTGATGATACTGC
GGAGAGCACGTGTGACGCAAAGAGAGAAGCGCGGGAGGAA
AACAAACGTCAACCTCGGCGGTTTTCTCCAGCGGCTCCTT
GAATGAACGAATGAATGGTATCTGATTCACCTGTTTGTAG
ATGGTGTGGCCTGTTTTTGTGTAAGACACGCAACAAAGAG
AAGATATTTTAATTGAGCAATATGACACTGGATTTACTAA
TAATTTCGTAATTCTTGGACATCTTGAAGTACTAACAGAT
ATGAATGTATTCAGTAATGCATAATGAAAAATAAACCCGA
AGATGATTGACAATAAAGAGACAAACTAATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations