header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5046
Transcript Name: ret-202
Previous Names: ret-002, ret1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021354 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021354|OTTDARG00000017726|ZDB-GENE-980526-307 ret|OTTDARP00000017992 ret1-002 LG_ BX005252.15 Danio rerio protein_coding KNOWN, 5094 bp
GGACTTTCGTGGCTCCTTTCGCTCGAATCAAAACAAGGCA
AAGTTCTGTTGTCAGGAATCAAAATACTTTTACCTGTTCG
TTGTGACATTACACTTATGATTGACAATTATGGGAAGTAC
GCGGGGAATCGTGTGGGGAGTGCTCCTGCTTCTCCTGTCT
GAAGGTTCATTCGGGCTGTATTTTCCTCAAAGGCTTTACA
CAGAGAACATCTACGTGGGTCAGCAGCAGGGATCACCGTT
GCTTCAGGTCATTTCAATGCGGGAATTCCCTACAGAGAGG
CCTTATTTCTTCCTGTGCTCGCACAGAGACGCTTTTACAT
CATGGTTTCACATAGATGAGGCGTCCGGAGTTCTTTATCT
CAACAAAACCCTGGAGTGGAGCGACTTCAGTAGTTTACGC
AGCGGCTCAGTTCGCTCCCCGAAGGATCTCACCCTGAAGG
TCGGAGTCTCTTCAACTCCCCCAATGAAAGTGATGTGCAC
CATCCTACCCACAGTGGAGGTCAAACTTTCGTTCATCAAT
GACACAGCGCCCTCCTGTGGTCAGGTCGAGCTCAGCACAT
TATGCTTCCCTGAGAAGATCTCCAACCCCCACATCACTGA
AAATCGCGAGCCAGGAGCCCTGCGCCAGCTGCGCCGCTTC
ACACACATGAGCATCTGCCCAAACTACACCATCAGCTATG
GAGTGGTTGCAGGATCTTCTGTACCGTTTGCGGTCGACGA
CTCCACTTCTGAACTAGTGGTCACAGCACAAGTGGACCGC
GAGGAGAAGGAAGTGTATCATCTGGATATAGTCTGTATGG
TACGAACAGAAAGAAATCTGGAGGAGGTCTTCAGATCTTT
ACATGTGAACATCTATGATGAAGATGATAATTCTCCTTAT
GTCAACGGGACTGACACTGAAGACGTCTTAGTAGAGTTTG
ACCGCAGTGAGGGTACTGTGTTTGGGACTCTGTTTGTATA
TGACAGAGACACAACACCAGTTTATCCCACAAACCAAGTT
CAAAATAAACTGGTGGGGACCCTGATGACAAATGACTCCT
GGATCAAAAATAATTTTGCTATTGAACACAAGTTTAGGGA
AGAGAAAGCTATTTTTGGAAATGTCCGTGGGACTGTTCAT
GAATACAAGCTGAAACTCAGTCAGAATCTGTCTGTGACGG
AGCAGCGCTCATTTCTGTTGGGCTACCTGGTCAATGACAC
CACTTTTCCAGGCCCAGAGGGAACAGTGCTGTTACACTTT
AATGTGACTGTCCTGCCAGTTCCCATTCGCTTCTCCAATG
TCACTTATTCCTTCACGGTCTCACAGAAGGCAACAACTTA
CTCCCAGATTGGAAAAGTCTGTGTGGAGAACTGTCAGAAG
TTTAAGGGCATTGATGTGACCTATCAGTTAGAGATTGTCG
ACAGGAACATCACTGCTGAAGCTCAGTCCTGTTACTGGGC
GGTTAGTCTTGCACAAAACCCGAATGATAATACAGGCGTT
CTCTATGTGAACGACACCAAAGTGTTACGCAGACCAGAGT
GCCAAGAGCTGGAGTATGTGGTCATTGCCCAGGAGCAGCA
GAACAAGCTTCAGGCCAAGACACAGCTCACCGTCAGTTTT
CAAGGCGAAGCAGATTCACTGAAAACGGATGAGCCACGAT
TTCCAGCTTGTGCAGAAAAGAGACAGCGAGGAGACTGTGA
GGCGACTCGAGGCCTGGGAGCCCCAACAGGGAGATGCCAG
TGGAGACAAGGCCGAGATAAAGGAATATCAAAAAGATACT
CCACCTGTTCCCCCAACCTCGGCACGTGCCCTGATGGTTA
CTGTGATGCCATTGAGAGCAAGAACATCTCCATCTGTCCT
CAGGATTGCTCCAGTGAGGCCATAATCGGCGGTTATGAAA
GGGACCTGTATGGAATCAAAGCTGGACATGGGACCTGTTA
CTGCTTTGAAGGAAAGTGCTTCTGTGAAAGAGATGAACCG
GAGGATGATATATGTAACGACATGTGCAAGACCGTCATTG
CAACTGGTATCATCCTGTCCTTCATTGTCTCCGTTCTCCT
GTCCTCGTACTTCATCCACCGTTACCACAAGACCACCCCA
AAGCCACCCATTGCTTCTGCTGAAATGACCTTCCGTCGGC
CAGCCCAGTCTTACCCTATCAGTTACTCGGCCAATAACGT
TCGTCGCGCTTCTCTCGATTCCATGGAGAACCAGGTGGCC
ATTGACACCTTCAAAATACCTGAGGATCCGAAATGGGAGT
TTCCACGAAAGAACCTGGTGTTGGGTAAAACTCTTGGAGA
AGGAGAGTTTGGGAAGGTGGTGAAGGCCACAGCTTTCCGA
CTCAAAGGAAAAGCTGGATACACTACGGTTGCTGTGAAAA
TGTTAAAAGAAAATGCATCTCACAGCGAGCTTCGAGACCT
CCTCTCAGAGTTCACATTGCTTAAGCAGGTTAATCACCCT
CATGTCATTAAAATGTATGGAGCTTGCAGCCAGGATGGTC
CATTATACTTAATTGTTGAATACGCCAAGTATGGTTCACT
ACGTAACTTCCTGAGAGAGAGCCGCAAAGTTGGGCCAAGC
TATATGGGCAATGATGCCAACCGCAACTCCAGCTACTTGG
AAAACCCAGACGAGAGAGCTCTGACCATGGGCGACCTGAT
CTCGTTCGCCTGGCAGATCTCTAGAGGAATGCAATACCTA
GCTGAGATGAAGCTTGTTCACAGAGACCTGGCTGCAAGGA
ATGTGCTGGTGGCAGAAGGAAGGAAGATGAAAATATCAGA
CTTTGGTTTGTCTCGAGATGTCTATGAGGAAGATTCATAC
GTGAAGAGGAGCAAGGGTCGTATTCCTGTCAAATGGATGG
CTATAGAGTCTTTGTTCGATCACATCTACACCACACAAAG
TGATGTCTGGTCATTTGGTGTTCTCTTATGGGAGATTGTG
ACTCTTGGAGGAAACCCCTACCCAGGAATTGCCCCTGAAC
GACTTTTCAACCTTCTGAAGACCGGCTACAGGATGGAGAA
ACCAGAGAACTGCACTGATGAAATGTACAATCTGATGCTT
CGCTGCTGGAAACAAGAGTCAGATAAACGTCCCACTTTCT
CAGACATCAGCAAAGAACTGGAGAAGATGATGGTGAAAAG
CAGAGACTATCTGGATCTTGCGGCCTCCACACCGGCAGAC
GCTCTCCTATATGACGACTCTCTCTCTGAAGAGGACACAC
CCTTAGTGGACTGTAGTAACGCCCCTCTCCCTCGAACCCT
CCCCTCCACTTGGATTGAAAACAAGCTCTATGGTAGAATT
TCCCATGCATTTACTAGATTCTAATACAGGGAACAAAATC
AGTTTATCTTTTGCCTTCCATAGGAAGAGCTGTGATTGTG
CTAACGGCATGGTTGCCAGCGACTTACCAATACTGCTCAC
GTTTTATAGATTCTGTAGTATCTGGATCTAGGGATCAGAT
GTGTCATTTGGACCTGCTTCCGATGTACTTTATTATCTGA
AATATACATTTTAAACGGATGTATTAGTATTCAAGTATTA
TTACTACTGATTTAAAAGTGAATTCATTTTTATATAAACA
CACACAGTGAGGAATTAATGTGTTTTTAGATTCACATTTG
TGAATTTTCTATTAGTTTGGCAGCACTTTAAGTTAGACTT
TTACATTTGAAACAGGTCCCCTGTGCTCTGGGTGTGCTCT
CTCTGTAATATCCTGAATGTATTACAGAAAATGAGTGTTT
AAAAGTAGATGGAGTCAGTTCTGAAAGCAGTAAGGCTTTT
GAATTTAACTCTTCCTTTTTTTTAAGATCATAAAAATATG
CAAGTGCTCCCCAAAAATGAGGCATTAACAGAGGAATAAC
TAAGCAATAAAATGGCCAGCAGTAAGGCAGTCGCTATGCA
TTTCTTGGAGTACACGAAAACGGATTATGTTTCATTTAAA
AGCATCTACTGTACATTTAAAAGCCAAAGACAACAATGAC
GTCACAGAATATACAATGTCACCGCAGCAGAATATTGACC
AAAAAACTCTCAAAGGACCAAAGAATGATTTCATGCTTAC
TGTGCTGTTTAATGTAACTGAGTTTTGTTCGAGAGCCTTA
CTGTCTGGACTTAATGCTTCCTCAGTGCAGAAAAAATCAT
ATGTTCTCGTTTTTAGGCATGTCATACCCGAACTGGCCAG
AGAAGAGCCCGGTACCGCTCAACAGACTCGATGCCACTAA
CCCTGTCTTTACAAGATATGCCAATGATAGTGTTTATGCA
AACTGGATGGCTTTGCATTCTCCCGCAAAAATCGTGGACA
CAATCGATAGTTAAAAACGCAAGCCAAAATCAATGGCGGA
AAAGACACGGGGGGTGGGGAGATGTGTATATTTCTATGAA
ACTGTATATATATATGTATATGTTGTATGATGATAAAGCG
GGTTCCCTTTTATTTCTGCTGTTGTGTAGATGATGAGAGA
TTTCAAATTGGCTGGAAATGCATAAACATGCTTCAAGCAG
CTTCTAGGTGATTGTTACCACGAGGCCTCCGTGCTGTATC
TCTGCATGACTCTGTACAGTTTAATGTCCATGTTTAAGTG
CCTGTGCCGCTTCTGTTAGAGAACACCATAATAAATGCAT
GACCGAGACGATCTTGGTCCCACTCCAGGAATTAAAGGGA
GCTTCTTTACCATCAATTACTGCAGAAGTTTGTCGCAAAT
ACTGGACATGTTTATTTGGAAAAAGAAAAGTTTGTTTTTT
CTTGATCGTGTGTGAGGATTGGAAAGAATCATGTTTATTT
TGTTTCCTTGTTTTTTAAGTAATGATATTTCTAGGCTCTG
TGGTGATAATGAGTTATGCATATTGCCATAACAGAGTATG
AATATGTTTAATTTAATGTCATATATTGTGATTTAATTTT
CATTCCCTGTAAAGACATTATTTGTGCAACAATAACTACA
TTAAGCTGAGTGTGATTCTTCAATATGTTGTCCGAAGATT
ACGTTTCAAACAATAAAACCTGTTAGAATATGTCTTGTTT
TCATTTCTGTGTGTTTCAGTTCTATTTCATTTTCAGACTT
CATGAAGATTAAAAGGCGATTTCTTCATTATATTCAAATA
AAACTCTCCCAAAA

ret TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ret-201 (1) 4230
ret-202 5094
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ret-202 Contained in:
OTHER ret-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021354 (1)
  • Ensembl_Trans:ENSDART00000139237 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)