ZFIN ID: ZDB-TSCRIPT-090929-4983
Transcript Name: hoxd13a-201
Previous Name: hoxd13a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021042 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021042|OTTDARG00000017439|ZDB-GENE-990415-119 hoxd13a|OTTDARP00000017732 hoxd13a-001 LG_ BX322661.17 Danio rerio protein_coding KNOWN, 1687 bp
AACGGAGATGTTATTTTCTGCGTGCATTTTTCTTGGTTTT
GAGCCCATAACAGACATGAGTTAAATCCCATGCACTGAGG
AATATGGACGGAGGAGGACTGGATGAAGAGTTTATAAATG
TTTACCCATCTGCCTTCGGGACTCACTCAAGCCGGTGTAC
ATCAGGAGCGCCGGTGCTCTCCGCTGTTGATCGACCGACT
TCTGTATGCAATGAGTCTATCAGTCCTTACTTTTCTTTTC
CATCCAATATCGGCTCTGGCTCCTTCACGTTTGGATGCCA
TTTGGAAAACAGTTACAAAGTTCCACAGAACGCCGTGTTC
CCGCCTGGTGTTGCGAAGCAAAACGGACAGTTCGCCAATA
AACCCGTGGACCACGGTGAAGCCTCCAGCTGGCTTAAAGA
GTTCGCCTTTTATCAAGGCTGCGCGCGCTCCTATCCGAGA
ATCCCTGCCTTCATTGATCTACCTGTGGTTCAGAGAGCAA
TGATGGGAGATCTTAGACATGAGACTTGTTTGACAATGGA
AGGCCACCAACATTGGGACTGGTCAAACAATTGCAGCAGT
CAACTTTATTGCTTTCAAGACCAGACGCGGAGCCCGCATA
TCTGGAAACCATCATTAACAGAGGAAGCAGCAGCGGCTTC
ATTCTGTCAGCGCGGGAGAAAGAAGCGGGTTCCTTACACA
AAATTTCAGCTGAAAGAGCTCGAGCGTGAATACAACACCA
CTAAGTTCATTACAAAGGAGAACAGACGGCGGATCGCTTC
TTCTACCAACCTGTCTGAGAGACAAGTAACTATATGGTTT
CAAAACCGACGGGTCAAGGATAAGAAGAGACCTGACGTCT
GCATCAAATGTTAATCCCATTGATATCTTTGTAGAGTTGG
TTTGCATAAAGTAAAGAGTATATTATAGTGGGATACAATG
TAAATTATACTTAGAAGTAATGTTAAACAGTTGGTTGTAT
TTGTCAATCAATGAATTCTCCCGTCAATTTCCTCTTTCCC
ATACACTCAAAATGTTATACTCTACATTTCCTTAAATTTG
AGTGCATAACTGTGTGCCATAGTTGTTTATATCAGACTTT
TATATGCAAAAAAGCTATAACATTGATTTCAAATAAAATA
CAATTAATAATAATGTACTTTATATCTACAAGTTTAATTA
CATTGAACTGAATATAAAAGCATTATACAGAATACTATTG
TGAAACTATTAAATTCATACGATCTCGGCTGTTTTCCGCC
CCCCAAAATGTATTTATATTTCGTTAAGCTCACACCTCTA
TAAATGTAGTTTTGTGGTCTTTTTTAAAAGTAGAACTATA
ATTTTATGTTGGTGTATTTTGATAAGCATAACATACAAAT
AATTTGTATAAAAGAGTGCTTTAGATGTGAATGGTCTACA
TAAACACACGATCGCGTTAAAGTATAAACTGAGTAGGCAA
TTTGTGAATTTTAGACTCGGTGTCTGAATAAGTTAATATG
AAGTGTGCACTATTAATGAAAGCATATTTTAAGCACGCAA
TCAGTACAATTTTATACATGCACACACATAATACATTTCG
ATAGTTGTTTGGTAATCAAGTGACAAGTTAATTCTTCCGG
GGGAATAAACAACTCCTTAAAAATCTGCTCAAAAATGTGT
GCTGTATTTTAAGATAAAACTGCACTTATAAAAATACCTA
AACATCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxd13a-201 Contained in:
[BAC] RP71-78H1 (1)

Genome Resources: Vega_Trans:OTTDART00000021042 (1),  Ensembl_Trans:ENSDART00000082332 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC153652 (1) 1716 nt
GenBank:BC091996 (1) 1200 nt
GenBank:CK688667 (1) 599 nt
GenBank:AL915408 (1) 586 nt
GenBank:CK685424 (1) 540 nt
GenBank:CR926784 (1) 539 nt
CITATIONS (2)