Transcript

acot13-202

ID
ZDB-TSCRIPT-090929-4825
Name
acot13-202
Previous Names
  • acot13-001
  • them2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020628 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020628|OTTDARG00000017116|ZDB-GENE-060503-437 acot13|OTTDARP00000017425 acot13-001 LG_ BX957279.13 Danio rerio protein_coding KNOWN, 580 bp
GTATAACTTGGGCCAGCTTTCAAGCGGTTTACAATAGTGA
ACTTGTCCTTCTCTGTGTTTTGTTACTTAATGCTAGAATC
AGTAATGGCTTCATTAACGCTGAATACAGTCAAACAGATC
TTCAGAGCGATGGCGGACAGTCCTGGGTTTGACCGGGTTT
TAAGTAAGGTGGAGGTTCTGTCTGCGGCTCCCGGTAAGGT
GGTGTGTGAGATGAAGGTGGAGGAGCAGCACACGAACAGA
GGGGGAACTCTTCACGGAGGAATGACAGCCACGCTCGTGG
ACATGATCTCCACCATGGCCATCATGTACAGTGAGAGAGG
AGCTCCTGGAGTCAGTGTGGACATGAACATAACATATATG
AATGCCGCTAAAATTGGAGAAGACATCCTGATCACTGCAC
AGGTTTTAAAACAAGGACGGACTCTGGCATTCGCAACAGT
AGATCTCACCAACAAGGCCAACGGAAAACTCATCGCTCAG
GGAAGACACACAAAACACCTCGGCAGCTAATTACGCACAT
GCCCTGTATATTATGTCTGTCTTGATGTTACGCAATAAAG
TCTGGCATCAAATTATGTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations