Transcript

si:ch211-147a11.3-202

ID
ZDB-TSCRIPT-090929-4694
Name
si:ch211-147a11.3-202
Previous Names
  • si:ch211-147a11.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020260 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020260|OTTDARG00000016825|ZDB-GENE-060503-102 si:ch211-147a11.3|OTTDARP00000017100 CH211-147A11.3-001 LG_ CR352301.7 Danio rerio protein_coding KNOWN, 1848 bp
TTTCTACGATGAATAGCTAGTCTAACTGACCACCCCATTT
AGTTTAGTCGTTACTCTGTGGTAAACCAAATTTCAGTGTT
TTTGTACAAAAGAACGATAACTGCTGTTACTCGATGAACA
TCAGCCGCTGACAAAGATACGCGTTTATTACATAAATAAA
GTTTTCAACCGGGAACTCGTGATTCTGCACAGTGTAGATT
ATCGTATATGGGCGGGACTTCAGTGGTTACCGGAGATAAA
CACAGGCTGGAGTCAGCGCTCGGTTTTGGACGCCTAAACT
TTCAATGAGGGCGAAGCAGACTGTCGTTGTGAGCCTCGGA
CAGCGAGTGTGCGGCGCTGTCTCTTTAAACCCGCCCGGTG
TGAAAAGTTCAGTCAAGAAGGCGGCAAAGAGGAGAGTTCT
GCTGCAGAGATCGGCGCCTGATATCGCGCGCGCTGTGCGA
CAGATGGCTGGCGACGGCGGCGAGGCCAAGCGGCTCCCGA
AGAGACCCTTTCACGGCGAAGTAGAGGAGAACTCAAGCGC
GGCTGTGGATGGAAACGTTAAAATTCAGCCCGGGAAAAAG
GCTCCTGGTGAACGGCGTGGTAAGGAGAACTCCGCCGCCA
AGTGCACGGGTTTGACAAGCGGCTCCGCAGAGGCGAAGAT
GGAGCAGAGCGTTCACGGCTCGCAGACCACAGACCCGAGC
GTTTTCTTCGACGAGGACAGCAATCATGTTTTCCCTGTGG
AGCAGTTCTTTGGGAACCTGGATGTTGTTGAGGATTACCC
CCGCAGAACTCCAGGCAGCAAAAGAATGACCCGGAGAGAG
TACAGGAGCATGCATTACTATGCCAAAGAGGACAGTGAAG
AAGAGCATCTATGAGGACTAAATCACTTCAGCTGCCGCTT
GCAGGAGTACAAATGACTGAAGAAGCGTCATGCTGGTAAA
ATGGACTTGATTTGTTTTAAAACAAGCTATTTTATTCTCT
TAACAATAGAGATGCCCTGTGTTGTTCAATCGGTAATGAG
GCACATTATAATCAAATGCAGAAATCCTGTGCATCCCTAA
TTATAAACTTAAGAGCATTCATTCAAGTGCTGCACTAAAA
GAATGTACAGTAAAAGGTTTTATGTGAGATTTCTGGTTTA
AAGCATCATGTGATTTGTCCCGAAAGAAGGCTATTTAAGG
AAAACTTGCGTACAAGTGTAATGGGGTTTCTACCATTTGT
TGTTACTTATGCGTTCATCCATCAAGTGCCTCATGTTTGA
TATTTAGACTTCGAAAGCAATTGAATACTAGCCTGTCCTT
TATGAATTTGGCACTTTTAAACATTCTTTGTTGAGAATGA
ATCCATTTGTTTTTGGAAAAAAAACACTTTATACTTCAGA
GTTGGTGCTGTATAATTGAAAGATAAAGCATGTAGATTTG
ACATATCTTAATTGCTCTTTGATATGCTCGATGTAAAGAA
TTTATATTGGCGTCTCAAATTAAGAGGATTTTATTGTAAG
ATTTTATTGTGAAATTGTCATTTTTAACATACAATTTGAA
TCTGTTATATGCATGTGGCTCCATCAGAATTTGTCTGTAT
ATGATATTTGTAAATTCGTCCGGATTTGCACTAACAAGAT
GTAACATTTTTACAGATGTAGTTTATTTGCGATTATGTAT
GAGGTAAAACTTGTAGAAAGTGTGATTTTTGAAGTTTATA
TTTTTCTATTGACGTGGTGAATCAAGTGCTAATTTTTGCT
ACCAAATGCCTTGTATGTACATGAAATGTAACTTATTTAA
TTTCTGATCTTCAGTGTATTATCATACAAAAAGCTAGAAT
ACTCCGTCCAGACAAAATAAACCTCATTTATGATTTGGGA
AACAATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations